-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
Authors: Jaqueline Goes de Jesus aff001; Gabriel da Luz Wallau aff002; Maricelia Lima Maia aff003; Joilson Xavier aff005; Maria Aparecida Oliveira Lima aff003; Vagner Fonseca aff005; Alvaro Salgado de Abreu aff005; Stephane Fraga de Oliveira Tosta aff005; Helineide Ramos do Amaral aff003; Italo Andrade Barbosa Lima aff001; Paloma Viana Silva aff001; Daiana Carlos dos Santos aff001; Aline Sousa de Oliveira aff001; Siane Campos de Souza aff001; Melissa Barreto Falcão aff004; Erenilde Cerqueira aff003; Laís Ceschini Machado aff002; Mariana Carolina Sobral aff002; Tatiana Maria Teodoro Rezende aff002; Mylena Ribeiro Pereira aff007; Felicidade Mota Pereira aff008; Zuinara Pereira Gusmão Maia aff008; Rafael Freitas de Oliveira França aff007; André Luiz de Abreu aff009; Carlos Frederico Campelo de Albuquerque e Melo aff010; Nuno Rodrigues Faria aff011; Rivaldo Venâncio da Cunha aff012; Marta Giovanetti aff005; Luiz Carlos Junior Alcantara aff005
Authors place of work: Laboratório de Patologia Experimental, Instituto Gonçalo Moniz, Fundação Oswaldo Cruz, Salvador, Brazil aff001; Departamento de Entomologia, Instituto Aggeu Magalhães, Fundação Oswaldo Cruz, Recife, Brazil aff002; Universidade Estadual de Feira de Santana, Feira de Santana, Brazil aff003; Secretaria de Saúde de Feira de Santana, Ministério da Saúde, Feira de Santana, Brazil aff004; Laboratório de Genética Celular e Molecular, ICB, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil aff005; KwaZulu-Natal Research Innovation and Sequencing Platform (KRISP), College of Health Sciences, University of KwaZulu-Natal, Durban, South Africa aff006; Departamento de Virologia, Instituto Aggeu Magalhaes, Fundação Oswaldo Cruz, Recife, Brazil aff007; Laboratório Central de Saúde Pública da Bahia, Salvador, Bahia, Brazil aff008; Secretaria de Vigilância em Saúde, Coordenação Geral de Laboratórios de Saúde Pública, Ministério da Saúde, Brasília, Brazil aff009; Organização Pan-Americana da Saúde/Organização Mundial da Saúde—(OPAS/OMS), Brasília, Brazil aff010; Department of Zoology, University of Oxford, Oxford, United Kingdom aff011; Departamento de Clínica Médica, Faculdade de Medicina, Universidade Federal do Mato Grosso do Sul, Campo Grande, Brazil aff012; Fundação Oswaldo Cruz, Rio de Janeiro, Brazil aff013; Laboratório de Flavivírus, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, Brazil aff014
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0226098Summary
The chikungunya East/Central/South/Africa virus lineage (CHIKV-ECSA) was first detected in Brazil in the municipality of Feira de Santana (FS) by mid 2014. Following that, a large number of CHIKV cases have been notified in FS, which is the second-most populous city in Bahia state, northeastern Brazil, and plays an important role on the spread to other Brazilian states due to climate conditions and the abundance of competent vectors. To better understand CHIKV dynamics in Bahia state, we generated 5 complete genome sequences from a local outbreak raised in Serraria Brasil, a neighbourhood in FS, by next-generation sequencing using Illumina approach. Phylogenetic reconstructions revealed that the new FS genomes belongs to the ECSA genotype and falls within a single strongly supported monophyletic clade that includes other older CHIKV sequences from the same location, suggesting the persistence of the virus during distinct epidemic seasons. We also performed minor variants analysis and found a small number of SNPs per sample (b_29L and e_45SR = 16 SNPs, c_29SR = 29 and d_45PL and f_45FL = 21 SNPs). Out of the 93 SNPs found, 71 are synonymous, 21 are non-synonymous and one generated a stop codon. Although those mutations are not related to the increase of virus replication and/or infectivity, some SNPs were found in non-structural proteins which may have an effect on viral evasion from the mammal immunological system. These findings reinforce the needing of further studies on those variants and of continued genomic surveillance strategies to track viral adaptations and to monitor CHIKV epidemics for improved public health control.
Keywords:
Genome analysis – Sequence alignment – Phylogenetic analysis – Brazil – Infectious disease surveillance – Chikungunya infection – Arboviral infections – Chikungunya virus
Introduction
Chikungunya virus (CHIKV) has emerged as a public health concern posing significant issues in tropical and subtropical regions [1]. Since 2004 it has been globally spread causing epidemics in more than 100 countries [2]. Four CHIKV lineages have been described: West African; East/Central/South African (ECSA); Asian; Indian Ocean Lineage (IOL) [3–5].
In Brazil, the first autochthonous cases of CHIKV were confirmed in September 2014 in the municipality of Oiapoque, Amapá state in the North of Brazil, followed by the city of Feira de Santana (FS), Bahia state in Northeast region, around seven days later [6]. By that time genomic analysis have identified the East/Central/South/Africa (ECSA) genotype for the first time in the Americas in FS and the municipality stood out in national scenario due to the large number of reported cases of the disease [6, 7].
Feira de Santana is an important city in Bahia state as it is surrounded by the biggest road network of the state, where thousands of passengers and freight vehicles transit, allowing a large flow of people favoring the introduction and spread of new viruses into the city and to other Brazilian regions [8].
Since 2014, Bahia state and specially FS have reported a large number of positive cases for CHIKV infection. Released data from the Brazilian surveillance health system (SINAN) indicates that Bahia state reported a total of 50,880 cases of chikungunya fever in 2016 and 1,524 chikungunya cases, until the 2019 25th epidemiological week (June/2019). In the same period FS reported more than 300 cases per 100 thousand habitants [9–10].
Here we report evidence of the persistence of CHIKV ECSA genotype and shed light on a localized outbreak raised in the Serraria Brasil, an upper medium class neighborhood within FS in 2016, two years after the lineage introduction in the locality.
Materials and methods
Ethics statement
This project was supported by the Pan American World Health Organization (PAHO) and the Brazilian Ministry of Health (MoH) as part of the arboviral genomic surveillance efforts of the ZiBRA project (www.zibraproject.org). Ethical approval for human samples was obtained from the Ethical Committee for Research from Gonçalo Moniz Institute, Oswaldo Cruz Foundation (IGM/FioCruz/BA) under CEP/CAAE number 45279715.8.0000.0040 and from Ethics Review Committee from PAHO under the reference number 2016-08-0029. Samples were provided for research and surveillance purposes within the terms of Resolution 510/2016 of CONEP (National Ethical Committee for Research, Ministry of Health).
Study population
Blood, urine and saliva samples (n = 69) from 27 patients presenting symptoms consistent with CHIKV infection from Serraria Brasil neighborhood were collected by active surveillance of Municipal Health Surveillance Division of Feira de Santana (SMS-SVS). Molecular diagnostics (RT-qPCR) were performed by Virology and Experimental Therapy Laboratory (LaVite) at Aggeu Magalhães Institute (IAM) FIOCRUZ-PE and specific CHIKV-IgG and CHIKV-IgM serology (ELISA - Enzyme-Linked Immunosorbent Assay) by Bahia state central public laboratory (LACEN-BA).
Viral RNA isolation and sample processing
Viral RNA was extracted from 200μL of clinical samples using QIAmp Viral RNA Minikit (Qiagen) according to the manufacturer’s instructions. Samples were linked to a digital record and clinical information such as date of onset of symptoms, sample collection date, municipality, state of residence, age, sex, residence type and when available, travel history.
Real-time quantitative PCR
Reverse transcription quantitative real-time PCR (RT-qPCR) was performed on samples using the GoTaq® Probe 1-Step RT-qPCR System (PROMEGA) on an ABI7500 Real Time PCR Systems or a QuantStudio® Systems (Applied Biosystems). The CHIKV non-structural protein 1 (nsp1) was targeted using the primers CHIKV-F (5’ to 3’: AAAGGGCAAACTCAGCTTCAC), CHIKV-R (5’ to 3’: GCCCTGGGCTCATCGTTATTC) and the CHIKV Probe (5’ to 3’: FAM-CGCTGTGATACAGTGGTTTCGTGTG), based on an assay previously described [11]. Thermocycler conditions consisted of reverse transcription at 45°C for 15 mins followed by RT inactivation at 95° C for 2 mins, 40 cycles of denaturation at 95°C for 15 sec and annealing at 60° C for 1min.
cDNA synthesis
All positive samples were submitted to a cDNA synthesis protocol using Protoscript II First Strand Sequencing kit (New England Biolabs—NEB). Then, a multiplex PCR was conducted using Q5 High Fidelity Hot-Start DNA Polymerase (New England Biolabs) and a sequencing primer scheme (divided into two separated pools) designed using Primal Scheme online tool to amplify 400 bp overlapping amplicons of the CHIKV complete genome (http://primal.zibraproject.org) [12]. All samples were subjected to 45 cycles of PCR using the thermocycling conditions of [12]. PCR products were purified using a 1x SPRI bead cleanup (Ampure XP Beads Agencourt) and concentrations were measured using a Qubit dsDNA High Sensitivity kit on a Qubit 3.0 fluorimeter (ThermoFisher).
Library prep sequencing for Illumina
Nextera XT Sample Preparation Kit (Illumina Inc) was used to construct a DNA library for each sample using dual barcodes. After library preparation each samples was quantified using Nebnext® library quant (Illumina Inc) following the manufacturer's instructions and normalized in equimolar quantities before loading the flow cell. The library was deep-sequenced using the MiSeq Illumina platform with 2 x 75 bp paired ends, which allow us to sequence both ends of a fragment and generate high-quality alignable sequence. Paired-end reads were demultiplexed using the vendor software from Illumina. Demultiplexed Illumina reads were mapped on the KP164568 reference genome using Bowtie2 program with default parameters (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322381/). Final consensus sequences were generated by the consensus module of Integrate Genome Viewer (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3346182/) with a 5x minimum read depth coverage. Any nucleotide variants on the primer regions were removed from the final consensus sequence.
Phylogenetic analysis
Nucleotide sequences recovered from this study were first subtyped using Chikungunya TypingTool (https://genomedetective.com/app/typingtool/chikungunya/) [13]. New sequences were aligned to complete or almost complete reference CHIKV genome sequences (>10,000 bp), retrieved from National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) covering all four existing lineages. Reference strains were included based on the following criteria: 1) published in peer-reviewed journals; 2) no uncertainty regarding lineage assignment of each sequence; 3) non-recombinant classification using RDP4 recombination detection software. Alignment was performed using MAFFT online program [14] and manually edited by using AliView [15]. A maximum likelihood phylogeny was reconstructed from the concatenated dataset (n = 225) using IQ-TREE 1.6.8 software under the HKY nucleotide substitution model with 4 gamma categories (HKY+4G) which was inferred in jModelTest as the best fitting model [16]. Statistical robustness of tree topology was inspected using 100 bootstrap replicates [17]; bootstrap value >90% was considered statistically significant. From the ML generated using the concatenated dataset we selected all ECSA taxa from Brazil (ECSA-BR dataset) (n = 36) samples in different states Alagoas n = 25; Bahia n = 5; Paraiba n = 2; Pernambuco n = 1; Rio de Janeiro n = 2; Sergipe n = 1.
Molecular clock phylogenetic analysis
In order to investigate the temporal signal in our CHIKV-ECSA dataset, we regressed root-to-tip genetic distances from this ML tree against sample collection dates using TempEst v 1.5.1 [18]. The ML phylogeny was used as a starting tree for Bayesian time-scaled phylogenetic analysis using BEAST 1.10.2 [19]. In the Bayesian analyses, we used an HKY+4G substitution model with a Bayesian skygrid coalescent model with 20 grid points [20]. We computed MCMC duplicate runs of 50 million states each, sampling every 5.000 steps for the ECSA-BR dataset. Convergence of MCMC chains was checked using Tracer v.1.7.1 [21]. Maximum clade trees were summarized from the MCMC samples using TreeAnnotator after discarding 10% as burn-in.
Single Nucleotide Polymorphisms (SNPs) analysis
Minority variants analysis
SAMtools and bcftools packages (https://www.ncbi.nlm.nih.gov/pubmed/19505943, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3198575/) were used to perform variant calling on .bam files using the paramenters “mpileup -Bu -d 50000” and “call -O b -v -c -” respectively. Additionally, VCFtools (https://academic.oup.com/bioinformatics/article/27/15/2156/402296) was used to annotate the variants with the following parameters (—filter Qual = 20/MinDP = 200/SnpGap = 20). Finally, we used SnpEff [22] on the .vcf file to gather further insights on the effects of the SNPs found.
Results
Sample collection, qRT-PCR screening and sequencing
The study group was composed by 27 patients, 74% (n = 20) female and 26% (n = 7) male individuals, who exhibited CHIKV symptoms as intense polyarthralgia with impaired walking (n = 27), myalgia (n = 27), headache (n = 27), fever (n = 25), backache (n = 24), exanthema (n = 22), conjunctivitis (n = 17), retro-orbital pain (n = 16), nausea (n = 15) and vomiting (n = 14) (S1 Table).
The 69 clinical samples collected were typed as blood (serum or plasma, n = 27), urine (n = 21) and saliva (n = 21). CHIKV IgM serology was positive for 17 cases (73,91%; S1 Table.), in two (11,76%) of those was possible to identify the presence of the virus genomic RNA through RT-qPCR on different cellular compartments (urine, blood and saliva). Samples tested by RT-qPCR showed cycle threshold values (Cts) ranging from 25,0 to 33,0 (Table 1). Median of RT-qPCR Cts for positive samples was 28.0, and was lower in blood (Ct 25, range: 25.0 to 28.0) than in urine (Ct 28.0) or saliva (Ct 33.0).
Tab. 1. Epidemiological data associated with isolates analysed in this study. Phylogenetic and molecular clock inference
To investigate and to better understand the diversity of CHIKV in some of most affected municipalities in Bahia state, we generated 5 CHIKV near-complete genomes (coverage range 88.90%-99.82%, mean = 97,4%) (Table 2) using next-generation sequencing technologies. A regression of genetic divergence from root to tip against sampling dates confirmed sufficient temporal signal (r2 = 0.80). Phylogenetic analysis indicates that new generated sequences belong to the ECSA genotype (S1 Fig) which was detected for the first time in 2014 in Feira de Santana in the Bahia state. ML and Bayesian phylogenetic analyses revealed that the ECSA sequences from Serraria Brasil neighbourhood form a single well supported clade (bootstrap support = 1.0; posterior probability support = 1.0) (Fig 1). We estimated the date of the most recent common ancestor (tMRCA) of the Feira de Santana Clade to be around Mid-May 2016 (95% Bayesian credible intervals, BCI: June 2015 –February 2016, Fig 1), suggesting a local persistence of the virus in Feira de Santana across a period of 2 years during distinct epidemic seasons.
Fig. 1. Phylogenetic analysis of chikungunya virus human samples from Feira de Santana, Bahia, Brazil. The municipality of Feira de Santana (FS) is located at a confluence of national highways. In A, federal highways BR-116 and BR-324 are shown in FS area. The BR-116 is the second longest highway in Brazil, it comprises 4,490 kilometers (2,790 mi) connecting Fortaleza (Ceará), one of the largest Northeast Brazil metropolises, to the southern city of Jaguarão, (Rio Grande do Sul), in the border with Uruguay. The BR-324 begins in Balsas (Maranhão) and ends in Salvador, where it plays an important role in connecting the road junction in FS to the capital, making it one of the main highways in the state. In B, new generated sequences belong to CHIKV-ECSA genotype and is clustered in a single strongly supported monophyletic clade that includes older FS sequences (bootstrap support = 98%) (orange). Tab. 2. Statistics for the 5 new CHIKV sequences generated in this study. Single Nucleotide Polymorphisms (SNPs)
We found a small number of SNPs per sample varying from 16 to 21 (b_29L and e_45SR = 16 SNPs, c_29SR = 29 and d_45PL and f_45FL = 21 SNPs). 71 out of 93 SNPs found are synonymous, 21 are non-synonymous and one generate a stop codon (Fig 2). Interestingly, 41 of all 93 SNPs detected are minor variants, that are supported by a substantial amount of reads but in a lower proportion compared with the reference nucleotide (S2 Fig). Eight of these correspond to non-synonymous changes.
Fig. 2. Single Nucleotide Polymorphisms (SNPs) analysis. Proportion of reads that supports each reference (blue) or SNP (red) variant. SNPs names denotes the position along the KP164568 reference genome following by the reference and variant nucleotide. Green, grey and brow SNPs names are non-synonymous, synonymous and stop codons SNPs. b_29L and c_29SR are blood from patient 1 (plasma and serum respectively); d_45PL correspond to plasma, e_45SR to serum and f_45FL to saliva from patient 2. Discussion
In this study, by performing Illumina approach sequencing, we generated 5 new CHIKV near-complete genomic sequences from 2016, collected in a neighbourhood in the municipality of Feira de Santana, Bahia state.
Our phylogenetic analysis showed that the novel genomes belong to ECSA genotype corroborating with previous studies [7, 23]. Although CHIKV is related to explosive outbreaks around the world [24–25], here we report a small local outbreak in Serraria Brasil, an upper medium class neighbourhood within FS.
Despite of the raising of outbreaks by new introductions of the virus into populations, our analysis shows that the novel sequences do not represent a re-introduction of the CHIKV into FS but confirm the basal circulation of the virus and its re-emergence in a local and susceptible population of FS, evidencing the persistence of the ECSA genotype in the region two years after its introduction.
The new genomes reported here were obtained from different cellular compartments of two CHIKV infected patients (Table 1). As reported in a previous study, blood, saliva and urine may also be used for the diagnosis of CHIKV infection, and the chances of detection are greatest when sampling occurs during the first week after the onset of symptoms [26]. These findings are particularly important for the genomic surveillance of arbovirus in regions with limited logistic structure, especially when the collection of blood samples, which is preferred, is not possible.
All 27 patients sampled in this study exhibited compatible symptoms for CHIKV infection. Taken together, these findings corroborate to other studies that demonstrate that 70% of CHIKV infection cases are symptomatic, since the virus rate of attack is high [27–28]. The difference of positive results between ELISA and RT-qPCR techniques is justified by the lack of time from the onset of symptoms and collection date performed, since the viremic peak–that would be detected by RT-qPCR–occurs in first days of infection [29, 23] unlike IgM antibodies levels that can be detected early as 5 days of infection up to 2 months [27, 29–31].
Localized outbreaks have been reported in other locations like the two small villages from Ravenna in Italy in 2007 [32] and more recently in Coutos neighbourhood of the city of Salvador, Bahia state, Brazil [33]. These outbreaks were related to high density of the mosquitoes, such as Aedes albopictus in the first study and Culex quinquefasciatus and Aedes aegypti in the second, although no CHIKV infected mosquito was reported. According to epidemiological surveillance data from Aedes aegypti Rapid Index Survey (LIRAa), the house index (HI) in FS was 2.27% in 2016 and 1.39% in 2017 [34]. The HI related to the infestation rates of Aedes aegypti mosquito [35] and provides qualified information for the municipalities to deploy arbovirus prevention and control strategies. According to Ministry of Health, HI values above 1% indicates risk of epidemics, thus, in 2016 FS was at risk of transmission of dengue and other arbovirus infections such as CHIKV [36] and may have had in impact on this outbreak.
The strategic location of the FS, at a road junction (Fig 1), where there is an intense movement of people from all Brazilian regions including other northeast cities, may further the circulation of infected patients or of subjects in the incubation period of arboviruses (DENV, CHIKV, ZIKV), that allied to climatic conditions and the density of Aedes mosquitoes [7], may contribute to virus dispersion within the region and beyond.
CHIKV infection in FS was characterized by two distinct epidemic waves (S3 Fig), the first one took place 3 months after the virus introduction by a returning traveller in 2014 and the second wave occurred in 2015 between 4th and 11th epidemiological weeks. Climate conditions and the HI related factors may have contributed for this epidemiological behaviour of CHIKV in FS. When the virus was introduced in July 2014, the climate conditions did not favor the reproduction and dispersion of Aedes mosquitoes (vector), although the population was immunologically susceptible [37]. On the other hand, a second epidemic wave occurred in a rain-intermittent period that contributes to urban and dwelling water accumulation and may have favored vector proliferation and expansion of infection. Also, the sub-notification of CHIKV cases by health care services may have masked the real range of the epidemy between the two waves [27,38].
The first epidemic wave initiated in George Americo neighborhood which reported the first cases of CHIKV in FS. That location represents the epicenter of the 2014 epidemy from where the infection expanded to surrounding neighborhoods [39]. Historically, the George Americo neighborhood is characterized by the low social status of its residents and by precarious sanitary conditions that might have favored the rapid dispersion of the CHIKV infection.
In contrast, Serraria Brasil neighborhood is placed far from the epicenter and is located in a region with better sanitary and environmental conditions since water supply and garbage collection services are provided more frequently by public services. We observed that along 2014 and 2015, the epidemic waves affected peripheral and more populous neighborhoods, while in 2016, when the epidemic has ceased, the reported cases predominate in less vulnerable neighborhoods, such as Serraria Brasil, where there was still susceptible population.
Regarding SNPs found in our analysis, previous studies have reported the occurrence of CHIKV mutations that modified its adaption to mosquito vectors such E1-A226V mutation, that increase IOL strain replication rate in Aedes albopictus [40–42]. We performed protein alignments to investigate the presence of the A226V (E1 protein) on the novel sequences generate in our study but we did not observe it. Also, the non-synonymous SNPs found here are not related to any known CHIKV mutations that increase the virus replication and/or infectivity in vector or mammalian hosts. However, several non-synonymous mutations, both fixed and minor variant, were found in non-structural proteins which may have an effect on viral evasion from the mammal immunological system as reported by others [43–45]. These findings reinforce the need of further studies and continuous genomic surveillance to track viral adaptations and to identify main sources of transmission for improved public health actions, especially regarding vector control once the increase of mosquito-borne diseases is associated to the occurrence of their competent vectors in conjunction with adequate climate conditions [46].
In addition, genomic surveillance is a powerful tool to monitor virus adaptation to mosquitoes vectors, making possible the study of CHIKV fitness and evolution in mosquito populations, foretelling increase in viral infectivity and the risk of its emergence [47]. Also, by using complete or near complete viral genomes, spatial-temporal analysis can be performed to infer viruses introduction and dispersion events in the past. This approach was employed in previous studies and have shown evidences of cryptic transmission of arboviruses such as Zika, dengue and chikungunya before the first case detection [48–50].
On this way the combination of genomic surveillance with established surveillance strategies can be employed to help health laboratories in monitoring circulating viruses and to predict upcoming outbreaks heading public health actions such as the reorganization of the health care network, the implementation of health education actions, social mobilization and vector control [51].
Together, our results indicate the persistence of CHIKV ECSA lineage in the municipality of Feira de Santana and shed light to the risk of rise of a new localized outbreak. Our findings reinforce the needing of continuous genomic surveillance strategies and further studies on minor variants to track viral adaptations and to improve our understanding about CHIKV circulation in FS and to prevent new epidemics.
Supporting information
S1 Fig [tif]
Maximum-likelihood phylogenetic tree.S2 Fig [tiff]
Chikungunya virus genetic statistics.S3 Fig [tif]
Chikungunya notified cases by epidemiological week (SE) in Feira de Santana-BA, 2014–2016.S1 Table [pdf]
Clinical data of cases included in the study.
Zdroje
1. Pathak H, Mohan MC, Ravindran V. Chikungunya arthritis. Clinical Medicine (London, England). 2019, 19(5):381–385. https://doi.org/10.7861/clinmed.2019-0035
2. Fu JYL, Chua CL, Vythilingam I, Sulaiman WYW, Wong HV, Chan YF, Sam IC. An amino acid change in nsP4 of chikungunya virus confers fitness advantage in human cell lines rather than in Aedes albopictus. Journal of General Virology. Oct/2019. https://doi.org/10.1099/jgv.0.001338.
3. Powers AM, Brault AC, Tesh RB, Weaver SC. Re-emergence of Chikungunya and O'nyong-nyong viruses: evidence for distinct geographical lineages and distant evolutionary relationships. J Gen Virol. 2000;81(Pt 2):471–9. doi: 10.1099/0022-1317-81-2-471 10644846
4. Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney MC, et al. Genome microevolution of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med. 2006;3(7):e263. doi: 10.1371/journal.pmed.0030263 16700631
5. Powers AM. Genomic evolution and phenotypic distinctions of Chikungunya viruses causing the Indian Ocean outbreak. Exp Biol Med (Maywood). 2011;236(8):909–14.
6. Nunes MRT, Faria NR, de Vasconcelos JM, Golding N, Kraemer MUG, de Oliveira LF, et al. Emergence and potential for spread of Chikungunya virus in Brazil. BMC Med. 2015;13 : 102. doi: 10.1186/s12916-015-0348-x 25976325
7. Rodrigues Faria N, Lourenço J, Marques de Cerqueira E, Maia de Lima M, Pybus O, Carlos Junior Alcantara L. Epidemiology of Chikungunya Virus in Bahia, Brazil, 2014–2015. PLoS Currents. 2016;8: ecurrents.outbreaks.c97507e3e48efb946401755d468c28. doi: 10.1371/currents.outbreaks.c97507e3e48efb946401755d468c28b2 27330849
8. Brasil. IBGE Cidades: Feira de Santana. Instituto Brasileiro de Geografia e Estatística (IBGE). 2017. https://cidades.ibge.gov.br/brasil/ba/feira-desantana/panorama.
9. Brasil. Boletim Epidemiológico: Monitoramento dos casos de dengue, febre de chikungunya e febre pelo vírus Zika até a Semana Epidemiológica 52, 2016. Secretaria de Vigilância em Saúde. Ministério da Saúde. Volume 48 N° 3–2017.
10. Brasil. Boletim Epidemiológico de Arboviroses, Bahia 2019. Diretoria de Vigilância Epidemiológica. Ministério da Saúde. Jun 2019.
11. Lanciotti RS, Kosoy OL, Laven JJ, Panella AJ, Velez JO, Lambert AJ, et al. Chikungunya virus in US travelers returning from India, 2006. Emerging infectious diseases. 2007;13 : 764–767. doi: 10.3201/eid1305.070015 17553261
12. Quick J, Grubaugh ND, Pullan ST, Claro IM, Smith AD, Gangavarapu K, et al. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nature protocols. 2017;12 : 1261–1276. doi: 10.1038/nprot.2017.066 28538739
13. Fonseca V, Libin PJK, Theys K, Faria NR, Nunes MRT, et al. (2019) A computational method for the identification of Dengue, Zika and Chikungunya virus species and genotypes. PLOS Neglected Tropical Diseases 13(5): e0007231. doi: 10.1371/journal.pntd.0007231 31067235
14. Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in bioinformatics. 2019;20 : 1160–1166. doi: 10.1093/bib/bbx108 28968734
15. Larsson A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics (Oxford, England). 2014;30 : 3276–3278. doi: 10.1093/bioinformatics/btu531 25095880
16. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nature methods. United States; 2012. p. 772. doi: 10.1038/nmeth.2109 22847109
17. Kozlov AM, Aberer AJ, Stamatakis A. ExaML version 3: a tool for phylogenomic analyses on supercomputers. Bioinformatics (Oxford, England). 2015;31 : 2577–2579. doi: 10.1093/bioinformatics/btv184 25819675
18. Rambaut A, Lam TT, Max Carvalho L, Pybus OG. Exploring the temporal structure of heterochronous sequences using TempEst (formerly Path-O-Gen). Virus evolution. 2016;2: vew007. doi: 10.1093/ve/vew007 27774300
19. Suchard MA, Lemey P, Baele G, Ayres DL, Drummond AJ, Rambaut A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus evolution. 2018;4: vey016. doi: 10.1093/ve/vey016 29942656
20. Gill MS, Lemey P, Faria NR, Rambaut A, Shapiro B, Suchard MA. Improving Bayesian Population Dynamics Inference: A Coalescent-Based Model for Multiple Loci. Mol Biol Evol. 2013;30 : 713–724. doi: 10.1093/molbev/mss265 23180580
21. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Systematic biology. 2018;67 : 901–904. doi: 10.1093/sysbio/syy032 29718447
22. Cingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang L, et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly. 2012;6 : 80–92. doi: 10.4161/fly.19695 22728672
23. Cunha MDP, Santos CA Dos, Neto DF de L, Schanoski AS, Pour SZ, Passos SD, et al. Outbreak of chikungunya virus in a vulnerable population of Sergipe, Brazil-A molecular and serological survey. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. 2017;97 : 44–49. doi: 10.1016/j.jcv.2017.10.01527
24. Morrison CR, Plante KS, Heise MT. Chikungunya Virus: Current Perspectives on a Reemerging Virus. Microbiol Spectr. 2016 Jun;4(3). doi: 10.1128/microbiolspec.EI10-0017-2016 27337473; PMCID: PMC6488301.
25. Morrison TE. Reemergence of chikungunya virus. J Virol. 2014 Oct;88(20):11644–7. doi: 10.1128/JVI.01432-14 Epub 2014 Jul 30. 25078691; PMCID: PMC4178719.
26. Musso D, Teissier A, Rouault E, Teururai S, de Pina J-J, Nhan T-X. Detection of chikungunya virus in saliva and urine. Virology Journal. 2016;13 : 102. doi: 10.1186/s12985-016-0556-9 27306056
27. Kariuki Njenga M, Nderitu L, Ledermann JP, Ndirangu A, Logue CH, Kelly CHL, et al. Tracking epidemic Chikungunya virus into the Indian Ocean from East Africa. The Journal of general virology. 2008;89 : 2754–2760. doi: 10.1099/vir.0.2008/005413-0 18931072
28. Yactayo S, Staples JE, Millot V, Cibrelus L, Ramon-Pardo P. Epidemiology of Chikungunya in the Americas. The Journal of infectious diseases. 2016;214: S441–S445. doi: 10.1093/infdis/jiw390 27920170
29. Johnson BW, Goodman CH, Holloway K, de Salazar PM, Valadere AM, Drebot MA. Evaluation of Commercially Available Chikungunya Virus Immunoglobulin M Detection Assays. The American journal of tropical medicine and hygiene. 2016;95 : 182–192. doi: 10.4269/ajtmh.16-0013 26976887
30. Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Secretaria de Atenção Básica Chikungunya: Manejo Clínico/ Ministério da Saúde, Secretaria de Vigilância em Saúde, Secretaria de Atenção Básica.–Brasília: Ministério da Saúde, 2017.
31. Ganesan VK, Duan B, Reid SP. Chikungunya Virus: Pathophysiology, Mechanism, and Modeling. Viruses. 2017;9 : 368. doi: 10.3390/v9120368 29194359
32. Rezza G, Nicoletti L, Angelini R et al. Infection with Chikungunya virus in Italy: an outbreak in a temperate region. Lancet 2007; 370 : 1840–6. doi: 10.1016/S0140-6736(07)61779-6 18061059
33. Tauro, Laura B, Cardoso, Cristiane W, Souza, Raquel L, Nascimento, Leile CJ, Santos, Daniela R dos, Campos, Gubio S, Sardi, Silvia, Reis, Olivete B dos, Reis,
34. Brasil. Boletim Epidemiológico: Monitoramento dos casos de dengue, febre de chikungunya e febre pelo vírus Zika até a Semana Epidemiológica 6, 2016. Ministério da Saúde. Secretaria de Vigilância em Saúde. 2016; 47(10):7. http://portalarquivos2.saude.gov.br/images/pdf/2016/marco/23/2016-007—DengueSE-6-publica—-o.pdf
35. Peres R. C., Rego R. and Maciel‐de‐Freitas R. (2013), The use of the Premise Condition Index (PCI) to provide guidelines for Aedes aegypti surveys. Journal of Vector Ecology, 38 : 190–192. doi: 10.1111/j.1948-7134.2013.12027.x 23701626
36. Brasil. Ministério da Saúde. OPAS. Divulgação dos dados do Levantamento Rápido de Índices para o Aedes aegypti. 2015. Available at https://www.paho.org/bra/index.php?option=com_content&view=article&id=4791:divulgacao-dos-dados-do-levantamento-rapido-de-indices-para-o-aedes-aegypti&Itemid=812.
37. Huits R, De Kort J, Van Den Berg R, Chong L, Tsoumanis A, Eggermont K, et al. Chikungunya virus infection in Aruba: Diagnosis, clinical features and predictors of post-chikungunya chronic polyarthralgia. PloS one. 2018;13: e0196630. doi: 10.1371/journal.pone.0196630 29709007
38. Pialoux G, Gauzere B-A, Jaureguiberry S, Strobel M. Chikungunya, an epidemic arbovirosis. The Lancet Infectious diseases. 2007;7 : 319–327. doi: 10.1016/S1473-3099(07)70107-X 17448935
39. Dias JP, Costa M da CN, Campos GS, Paixao ES, Natividade MS, Barreto FR, et al. Seroprevalence of Chikungunya Virus after Its Emergence in Brazil. Emerging infectious diseases. 2018;24 : 617–624. doi: 10.3201/eid2404.171370 29553317
40. Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney M-C, et al. Genome microevolution of chikungunya viruses causing the Indian Ocean outbreak. PLoS medicine. 2006/05/23. 2006;3: e263–e263. doi: 10.1371/journal.pmed.0030263 16700631
41. Tsetsarkin KA, Chen R, Leal G, Forrester N, Higgs S, Huang J, et al. Chikungunya virus emergence is constrained in Asia by lineage-specific adaptive landscapes. Proceedings of the National Academy of Sciences of the United States of America. 2011;108 : 7872–7877. doi: 10.1073/pnas.1018344108 21518887
42. Rodas JD, Kautz T, Camacho E, Paternina L, Guzman H, Diaz FJ, et al. Genetic Characterization of Northwestern Colombian Chikungunya Virus Strains from the 2014–2015 Epidemic. The American journal of tropical medicine and hygiene. 2016;95 : 639–646. doi: 10.4269/ajtmh.16-0091 27430542
43. Akhrymuk I, Kulemzin S V, Frolova EI. Evasion of the innate immune response: the Old World alphavirus nsP2 protein induces rapid degradation of Rpb1, a catalytic subunit of RNA polymerase II. Journal of virology. 2012;86 : 7180–7191. doi: 10.1128/JVI.00541-12 22514352
44. Fros JJ, van der Maten E, Vlak JM, Pijlman GP. The C-terminal domain of chikungunya virus nsP2 independently governs viral RNA replication, cytopathicity, and inhibition of interferon signaling. Journal of virology. 2013;87 : 10394–10400. doi: 10.1128/JVI.00884-13 23864632
45. Jones PH, Maric M, Madison MN, Maury W, Roller RJ, Okeoma CM. BST-2/tetherin-mediated restriction of chikungunya (CHIKV) VLP budding is counteracted by CHIKV non-structural protein 1 (nsP1). Virology. 2013;438 : 37–49. doi: 10.1016/j.virol.2013.01.010 23411007
46. European Centre for Disease Prevention and Control. Guidelines for the surveillance of native mosquitoes in Europe. Stockholm: ECDC; 2014. doi: 10.2900/37227
47. Naveca FG, Claro I, Giovanetti M, de Jesus JG, Xavier J, Iani FC de M, et al. Genomic, epidemiological and digital surveillance of Chikungunya virus in the Brazilian Amazon. PLoS neglected tropical diseases. 2019;13: e0007065. doi: 10.1371/journal.pntd.0007065 30845267
48. Xavier J, Giovanetti M, Fonseca V, Theze J, Graf T, Fabri A, et al. Circulation of chikungunya virus East/Central/South African lineage in Rio de Janeiro, Brazil. PloS one. 2019;14: e0217871. doi: 10.1371/journal.pone.0217871 31185030
49. Faria NR, da Costa AC, Lourenc¸o J, Loureiro P, Lopes ME, Ribeiro R, et al. Genomic and epidemiological characterisation of a dengue virus outbreak among blood donors in Brazil. Sci Rep. 2017; 7 (1):15216. doi: 10.1038/s41598-017-15152-8 29123142
50. Faria NR, Quick J, Claro IM, The´ze´ J, de Jesus JG, Giovanetti M, et al. Establishment and cryptic transmission of Zika virus in Brazil and the Americas. Nature. 2017; 546(7658):406–10. doi: 10.1038/nature22401 28538727
51. Lima MM, Cerqueira EM, Falcão MB, Cerqueira HML, Cunha RV, Alcantara LCJ. (Re) organização da vigilância epidemiológica no enfrentamento da tríplice epidemia de dengue, chikungunya e Zika: desatando nós e buscando caminhos. Patologia das doenças 2 [recurso eletrônico] / Organizadora Yvanna Carla de Souza Salgado.–Ponta Grossa (PR): Atena Editora, 2018.–(Patologia das Doenças; v. 2)
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
Článok vyšiel v časopisePLOS One
Najčítanejšie tento týždeň
2020 Číslo 1- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Masturbační chování žen v ČR − dotazníková studie
- Nejasný stín na plicích – kazuistika
- Kombinace metamizol/paracetamol v léčbě pooperační bolesti u zákroků v rámci jednodenní chirurgie
- Eliquis (apixaban) nově hrazen ze zdravotního pojištění
-
Všetky články tohto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- In vivo elongation of thin filaments results in heart failure
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- Efficient processing of raster and vector data
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- Dome-shaped macula in children and adolescents
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Exploring the impact of terminology differences in blood and organ donor decision making
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- Human-raptor conflict in rural settlements of Colombia
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- Psychometric validation of Czech version of the Sport Motivation Scale
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy