-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
Authors: Hiroyuki Yamazaki aff001; Kotaro Shirakawa aff001; Tadahiko Matsumoto aff001; Yasuhiro Kazuma aff001; Hiroyuki Matsui aff001; Yoshihito Horisawa aff001; Emani Stanford aff001; Anamaria Daniela Sarca aff001; Ryutaro Shirakawa aff002; Keisuke Shindo aff001; Akifumi Takaori-Kondo aff001
Authors place of work: Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, Kyoto, Japan aff001; Department of Molecular and Cellular Biology, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan aff002
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0223463Summary
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (APOBEC) DNA cytosine deaminase 3B (A3B) is a DNA editing enzyme which induces genomic DNA mutations in multiple myeloma and in various other cancers. APOBEC family proteins are highly homologous so it is especially difficult to investigate the biology of specifically A3B in cancer cells. To easily and comprehensively investigate A3B function in myeloma cells, we used CRISPR/Cas9 to generate A3B reporter cells that contain 3×FLAG tag and IRES-EGFP sequences integrated at the end of the A3B gene. These reporter cells stably express 3xFLAG tagged A3B and the reporter EGFP and this expression is enhanced by known stimuli, such as PMA. Conversely, shRNA knockdown of A3B decreased EGFP fluorescence and 3xFLAG tagged A3B protein levels. We screened a series of anticancer treatments using these cell lines and identified that most conventional therapies, such as antimetabolites or radiation, exacerbated endogenous A3B expression, but recent molecular targeted therapeutics, including bortezomib, lenalidomide and elotuzumab, did not. Furthermore, chemical inhibition of ATM, ATR and DNA-PK suppressed EGFP expression upon treatment with antimetabolites. These results suggest that DNA damage triggers A3B expression through ATM, ATR and DNA-PK signaling.
Keywords:
Mutation – Cloning – Cancer treatment – Flow cytometry – Polymerase chain reaction – Plasmid construction – DNA damage – Myeloma cells
Introduction
The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like DNA cytosine deaminase 3 family (APOBEC3, A3) consists of seven proteins (A3A, A3B, A3C, A3D, A3F, A3G and A3H) that preferentially induce C to U mutations in single strand DNA. A3 proteins were originally identified as factors of the innate immunity due to their mutagenic activity on viral genomes, and have recently joined the growing list of key intrinsic mutagens that play a part in oncogenesis [1]. Evidence for A3 mutagenicity consists of the presence of their mutational signature in cancer genomes [2], the effects observed when overexpressed in tumor tissues [3, 4], as well as the correlation of APOBEC signature mutations with poor prognosis [5, 6]. Nevertheless, the precise biology of each APOBEC3 protein in cancer cells remains unknown. Due to the high structural homology of APOBEC3 family members, it is particularly difficult to obtain high-affinity - and high-specificity - antibodies against each APOBEC3 protein, which limits our capability to distinguish the precise role of each endogenous APOBEC3 during tumorigenesis.
Among APOBEC3s, we previously reported that endogenous A3B is overexpressed and seems to be the main source of deamination activity in most of the myeloma cell lines we examined [7]. Notably, high levels of A3B expression in tumor cells were an independent risk factor for the overall survival of myeloma patients [7] as well as of other cancer patients [8–11]. However, the regulatory mechanisms that mediate A3B expression have not been well studied. To date, molecules including cell cycle pathway [12] and DNA damage response (DDR) [13, 14] factors and several transcription factors such as human papillomavirus E6/E7 [15, 16], NF-κB [17, 18], c-Maf [5] and B-Myb [19] were reported to enhance A3B expression. Nevertheless, how these factors mediate A3B expression and how A3B contributes to tumor progression and/or acquisition of chemoresistance in myeloma cells remains unclear. To investigate A3B-associated myeloma biology, we used the CRISPR/Cas9 system to introduce the 3×FLAG tag and the IRES–EGFP gene at the beginning of the 3’ UTR of the A3B gene in three human myeloma cell lines. We utilized this reporter cell lines to screen for how A3B expression is affected by anticancer treatments. Overall, we found these reporter cell lines to be very useful for the comprehensive analysis of A3B biology.
Materials and methods
Human cell lines and culture
Three human myeloma cell lines, U266, RPMI8226 and AMO1 cells were maintained in RPMI1640 (Nacalai) containing 10% FBS and 1% PSG (Invitrogen). HEK293T and Lenti-X cells were maintained in DMEM (Nacalai) containing 10% FBS and 1% PSG (Invitrogen).
sgRNA design and construction of A3B reporter donor DNA
To design the single-guide RNA (sgRNA), the mRNA sequence of APOBEC3B (APOBEC3B Homo sapiens chromosome 22, GRCh38 Primary Assembly mRNA variant1, Fig 1A) was imported into CRISPRdirect [20]. After a target site was determined, annealed oligos (S1 Table) were inserted into pSpCas9(BB)–2A–Puro (PX459) V2.0 (Addgene, #62988) using the BbsI (New England Biolabs) cloning site, or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs) cloning site as previously described [21, 22]. For the construction of the donor DNA vector (Fig 1B), the right homology arm, the modified cassette including the 3×FLAG–IRES–EGFP gene and the left homology arm were PCR-amplified using KOD FX Neo (ToYoBo). Each PCR primer pair contained around 15 bp overlaps. All the amplicons were cloned into the lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid (Fig 1C).
Fig. 1. Schema of APOBEC3B editing strategy. (A) Schema of A3B mRNA structure. Triangles indicate highly-specific sgRNA target sites within A3B. Each arrow represents an exon (Ex). Areas in light gray show UTRs, those in dark gray show coding sequence regions (CDRs), and those in blue show catalytic domains. A3B mRNA isoforms (arrows in orange) as well as shA3B target sites (rectangles in yellow) are also indicated. (B) Schema of A3B in the host genome and in the donor DNA template. The donor DNA template contains six silent mutations in the sgRNA #4 target site, and intron 7 was removed. The 3×FLAG–IRES–EGFP sequence was inserted adjacent to the beginning of 3’ UTR. (C) Schema of donor DNA plasmid, pCSII–CMV:A3B–3×FLAG–IRES–EGFP. Validation of sgRNA targeting efficiency
293T cells were transfected with pSpCas9(BB)–2A–Puro:sgRNA #4 (0.5 μg) using the FuGENE HD Transfection Reagent (Promega). Two days after transfection, 293T cells were harvested and their genomic DNA extracted using the QuickGene DNA whole blood kit S (KURABO). The targeted region was PCR-amplified from genomic DNA using the targeting test primers (S1 Table). The PCR products (200 ng) were denatured and then re-annealed to form heteroduplex DNA. The hybridized DNA was digested with T7 endonuclease I (T7E1, New England Biolabs), and run on 2% agarose gel. Mutation frequency was calculated based on band intensity, using Image J software, as previously described [23].
Generation of A3B reporter cell lines
For the U266 and AMO1 cell lines, 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)–2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R, program X-001. For the RPMI8226 cell line, 5 × 106 cells were transduced with lentiCRISPR ver.2:sgRNA #4 viruses and pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA viruses, simultaneously. These lentiviruses were produced by co-transfection of the packaging plasmid pVSVg (Addgene, #8454), psPAX2-D64V (Addgene, #63586) and lentiCRISPR ver.2:sgRNA #4 plasmid, or pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid, into Lenti-X cells.
Flow cytometry analysis
Myeloma cells were stained with DRAQ7 (Biostatus) to mark dead cells, then were read on BD FACS Calibur or BD FACS Lyric (Becton-Dickinson Biosciences). To isolate A3B reporter cell lines, EGFP positive cells were sorted using a FACS Aria III cell sorter (Becton-Dickinson Biosciences) at seven days after transfection or transduction. The data was analyzed using the software FCSalyzer ver. 0.9.15-alpha. (https://sourceforge.net/projects/fcsalyzer/).
Genotyping of A3B reporter single cell clones
Single cell clones were isolated from the sorted EGFP-positive cells of the three myeloma cell lines by limiting dilution. These clones were then PCR-genotyped using 2 pairs of the target confirmation primers, forward #a and reverse #b, and forward #c and reverse #b. To confirm the full sequence of A3B–3×FLAG–IRES–EGFP mRNA from the established cell line, complementary DNA (cDNA) was synthesized as described below, and was PCR-amplified by KOD FX Neo (ToYoBo) using a pair of primers, forward #d and reverse #e. The PCR products were sequenced using the 3130xl Genetic Analyzer (Applied Biosystems). All primers for PCR are listed in S1 Table.
Immunoblot analysis
Whole cell lysates from 5.0 × 106 cells, prepared using an SDS-based buffer (5 mM EDTA, 1% SDS) supplemented with Protease inhibitor cocktail (Roche) and PhosSTOP EASY (Roche), were mixed with an equal volume of twofold concentrated sample buffer (Bio-Rad Laboratories) containing β-mercaptoethanol (Nacalai Tesque), and were treated for 5 min at 100°C. Immunoblot analysis was performed as described previously using a mouse anti-FLAG antibody (Millipore, clone JBW301) or a mouse anti-α-tubulin monoclonal antibody (AA13, Funakoshi).
Immunofluorescence assays
Cells were air-dried and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 minutes on glass slides using Shandon cytospin 2 (THERMO FISHER SCIENTIFIC). Fixed cells were permeabilized, reduced and denatured for 30 minutes in PBS buffer containing 0.5% SDS, 5% β-mercaptoethanol and 10% FBS. Then, cells were washed three times with PBS containing 4% FBS and 0.1% Triton X-100 (PFT buffer) [24], and incubated with a purified mouse anti-FLAG antibody for 1 hour. Subsequently, cells were incubated with a goat anti-mouse IgG (H+L)-Alexa Flour® 594 preadsorbed antibody (Abcam, ab150120) for 30 min in the dark. All antibodies were diluted with 3% BSA and 0.5% Tween in PBS. Then, the cells were stained with DAPI and were observed with a confocal laser scanning microscope (TCS-SP8, Leica).
Knockdown experiments
We constructed pSicoR-mCherry lentiviral vectors [25] expressing short-hairpin RNA (shRNA) against A3B by inserting synthetic double-stranded oligonucleotides, as previously described [7] (TRCN0000140546 [26], sense oligo, 5’-TGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAAGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCA-3’; TRCN0000139463, sense oligo, 5’-TCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAACCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGA-3’) into the cloning site. For non-target shRNA, we used two constructs that were cloned as scrambled sequences (control [27], sense oligo, 5’-TGTCAAGTCTCACTTGCGTCTTCAAGAGAGACGCAAGTGAGACTTGACTTTTTTC-3’, antisense oligo, 5’-TCGAGAAAAAAGTCAAGTCTCACTTGCGTCTCTCTTGAAGACGCAAGTGAGACTTGACA-3’; control-2 [28], sense oligo, 5’-TATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGCGAGATTTTTTTC-3’, antisense oligo, 5’-TCGAGAAAAAAATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGCGAGATA). The lentivirus was produced by co-transfection of Trans-Lentiviral packaging plasmid mix (GE Dharmacon) and pSicoR-mCherry into Lenti-X cells.
Quantitative RT-PCR
Total RNA was extracted from cell lines using the High Pure RNA isolation kit (Roche). cDNA was synthesized using the PrimeScriptR II 1st strand cDNA Synthesis Kit (Takara) by random primer and oligo dT primer mixture. Real-time PCR was performed using the Thunderbird SYBR qPCR Mix (ToYoBo). Target gene expression levels were normalized by endogenous expression levels of HPRT1. All primers for real-time PCR are listed in S1 Table.
Anticancer treatment screening
To examine the effects of chemotherapeutic agents on A3B expression, the A3B reporter cells were cultured for two days at a concentration of 2 × 105 cells/well/1.5 mL medium in 12-well plates and treated with phorbol 12-myristate 13-acetate (PMA, Sigma), melphalan (MEL, Wako), cisplatin (CDDP, Nihon-kayaku), mitomycin C (MMC, Funakoshi), N-desacetyl-N-methylocolchicine (COL, KaryoMAX Colcemid Solution in PBS, Thermo Fisher), camptothecin (CPT-11, TopoGEN), etoposide (VP-16, TREVIGEN), cytosine-1-B-D(+)-arabinofuranoside (Ara-C, Wako), gemcitabine hydrochloride (GEM, Sigma), hydroxyurea (HU, Tokyo chemical industry), aphidicolin (APH, Wako), bortezomib (BOR, Funakoshi), lenalidomide (LEN, Sigma), elotuzumab (ELO, Bristol-Myers Squibb), human IFN-α (Sumiferon, Dainippon Sumitomo Pharma) or olaparib (Funakoshi) at several concentrations as described in the main text. These chemotherapeutics were dissolved in 100% dimethyl sulfoxide (Nacalai Tesque) with the exception of COL, HU, ELO and INF-α which were dissolved in distilled water. To examine the effects of radiation or UV on A3B expression, the cells were exposed to gamma radiation using a Cs-137 Gamma Cell or to UVC using a FUNA UV Crosslinker, FS-800 (Funakoshi). To examine the effects of kinase inhibitors on A3B regulation, KU-55933 (Selleck), VE-821 (Selleck), NU-7026 (Selleck) or CGK733 (Calbiochem) were added 2 hours prior to antimetabolite treatment.
Statistical analysis
Mann-Whitney U test and Welch’s t test were calculated to evaluate the differences in continuous variables between two groups for quantitative RT-PCR results and flow cytometry results, respectively, by using the EZR software (version 3.0.2, Saitama Medical Center, Jichi Medical University) [29].
Results
CRISPR design
We first designed sgRNA candidates for target sites in A3B, excluding introns, using the web based tool, CRISPRdirect [20]. There are only four highly specific candidates for A3B (Fig 1A and S2 Table) mainly due to the high homology among APOBEC3 family genes. In order to insert the 3×FLAG sequence into A3B with a minimal off-target effect, we selected sgRNA #4 (Fig 1A). U266, RPMI8266 and AMO1 endogenously overexpress A3B [7]. We used the pSpCas9(BB)–2A–Puro plasmid and the lentiCRISPR ver.2 plasmid to transduce the CRISPR system that targets APOBEC3B loci in these cell lines. We also used a donor DNA template to introduce the 3×FLAG and IRES-EGFP reporter sequences at the end of the coding region and to move the stop codon behind the 3×FLAG sequence (Fig 1B and 1C). The 3×FLAG–IRES–EGFP cassette was located adjacent to the beginning of 3’ UTR, and intron 7 (281bp) was removed to prevent it from becoming the right homology arm. Usually, the PAM sequence (NGG) in the donor DNA template must be mutated to prevent cutting by Cas9, however, in our case, any mutation of PAM would lead to alteration of the A3B protein sequence. Instead, we designed six silent mutations within the target site to inhibit efficient future sgRNA binding: the host genomic target sequence of sgRNA #4, ‘ctgGGACACCTTTGTGTACCGCCAGGgat’, was altered to ‘ctgGGACACGTTCGTCTATCGACAAGgat’, in the donor DNA template sequence. Finally, the complete donor DNA template sequence was inserted into the pCSII–CMV–MCS plasmid in the opposite direction of the CMV promoter of the parental vector (Fig 1C), so that cells in which the donor DNA vector is present merely transiently would not express EGFP and only cells which had their genome successfully engineered would emit EGFP fluorescent signals.
CRISPR guided 3×FLAG–IRES–EGFP insertion in A3B locus
To test the targeting efficiency of the sgRNA, we transfected the pSpCas9(BB)–2A–Puro:sgRNA #4 plasmid into 293T cells. The transfection efficiency was 15.2% (T7E1 assay, Fig 2A), therefore, we proceeded to co-transfect/co-transduce Cas9, the sgRNA #4 expressing vector and the donor DNA vector into U266, RPMI8226 and AMO1 cell lines. As expected, the efficiency of genome editing in myeloma cells was quite low, but we successfully enriched EGFP positive cells by cell sorting (Fig 2B). Single clones were isolated by limiting dilution from each cell line, expanded and A3B genotype was confirmed by PCR. Out of all the isolated clones, we selected the following four edited cell lines: U266A3B–3×FLAG–IRES–EGFP #1 and #2 (U266 KI #1 and #2), RPMI8226A3B–3×FLAG–IRES–EGFP (RPMI8226 KI), and AMO1A3B–3×FLAG–IRES–EGFP (AMO1 KI). According to the genotype PCR in Fig 2C, the A3B–3×FLAG–IRES–EGFP cassette was correctly integrated at the target site in these cell lines. Of note, both A3B alleles in U266 KI #2 were edited (Fig 2C). To confirm the mRNA sequence of A3B–3×FLAG–IRES–EGFP, we PCR-amplified the full length of the cDNA derived from each cell line (Fig 2D) and performed Sanger sequencing analysis. As desired, all the engineered cell lines possessed correct A3B–3×FLAG sequences, including the intended 6 silent mutations in the sgRNA target site and SNPs in the unmanipulated region (Fig 2E). According to flow cytometry analysis, the intensity of the fluorescent signal increased in the order of U266 KI #1, RPMI8226 KI and AMO1 KI, which is consistent with their A3B expression levels in a previous report [7]. U266 KI #2 exhibited around two times stronger fluorescence than U266 KI #1, indicating that the 3×FLAG–IRES–EGFP gene was integrated homozygously in U266 KI #2 and heterozygously in U266 KI #1. According to the results of flow cytometry and PCR-genotyping (Fig 2C), RPMI8226 KI and AMO1 KI contain a single allele of the 3×FLAG–IRES–EGFP gene. Immunoblot analysis also confirmed that all the cell lines produced A3B–3×FLAG proteins of the predicted size (Fig 2G). Immunofluorescent analysis of the subcellular localization of A3B–3×FLAG proteins showed a dominant localization in the nucleoplasm (Fig 2H), which is identical with that of wild type A3B proteins [7].
Fig. 2. Establishment of A3B–3×FLAG–IRES–EGFP knock-in myeloma cell lines. The established A3B–3×FLAG–IRES–EGFP knock-in cell lines work as A3B reporters
To verify the feasibility of the established cell lines as A3B reporters, we first transduced RPMI8226 KI and AMO KI cells with lentiviral shRNA against A3B together with an EF1α-driven mCherry fluorescent marker. When A3B mRNA was efficiently depleted (Fig 3A), A3B–3×FLAG protein levels decreased as expected (Fig 3B). Similarly, EGFP fluorescence intensity decreased in mCherry positive, shRNA transduced cells, compared with mCherry negative, shRNA non-transduced cells (Fig 3C–3F). Next, we treated U266 KI #1, RPMI8226 KI and AMO1 KI cells with PMA, a PKC activator, which is known to upregulate A3B expression via the NF-κB pathway [17, 18]. A quantitative RT-PCR analysis confirmed the enhancement of A3B mRNA levels for each cell line (Fig 3G). Consistently, immunoblot analysis detects increases of A3B–3×FLAG proteins (Fig 3H), and flow cytometry analysis detects peak shifts and increases of mean fluorescent intensity (MFI) for each cell line (Fig 3I and 3J). Based on the above results, we conclude that these established cell lines can be used as reliable A3B reporters.
Fig. 3. A3B–3×FLAG–IRES–EGFP knock-in cells work as A3B reporters. (A, B) Real-time PCR (A) and immunoblotting (B) of A3B in RPMI8226 KI cells and AMO1 KI cells, which were transduced with lentiviral shRNA against A3B (two constructs: shA3B or shA3B-2) or control (two constructs: control or control-2). HPRT1 or α-tubulin were evaluated as internal controls. Mann-Whitney U tests were used to compare the results between control and A3B knockdown samples: **P < 0.01; *P < 0.05. (C, D) Flow cytometry of RPMI8226 KI cells (C) and AMO1 KI cells (D) at 17 days after transduction with lentiviral shRNA against A3B or control. In the histogram representation, EGFP intensity was compared between mCherry positive cells (colored in red) and mCherry negative cells (colored in green). (E, F) Bar graph of EGFP mean fluorescence intensity (MFI) of the experiments in Figures (C, D). Mann-Whitney U tests were performed to compare the results between mCherry negative and mCherry positive samples: **P < 0.01; *P < 0.05. (G, H) Real-time PCR (G) and immunoblotting (H) of A3B in three A3B–3×FLAG–IRES–EGFP knock-in cell lines, which were treated with PMA (20 ng/mL) for 6 hours and 24 hours, respectively. Mann-Whitney U tests were performed to compare the results between control and PMA-treated samples: **P < 0.01. (I) Representative result of EGFP intensity histogram of AMO1 KI cells, which were treated with PMA (20 ng/mL) for 2 days. (J) Bar graph of EGFP mean fluorescent intensity (MFI) of three A3B–3×FLAG–IRES–EGFP knock-in cell lines, which were treated with PMA (20 ng/mL) for 2 days. Mann-Whitney U tests were performed to compare the results between control and PMA-treated samples: **P < 0.01. DDR upregulates A3B expression via all the DDR-PIKK pathways in myeloma cells
Because the established A3B reporter cell lines provide an easy way to evaluate the alteration of A3B expression by simply performing flow cytometry analysis, we investigated which of the current clinically approved myeloma treatments affect A3B expression. Interestingly, most conventional anticancer treatments which induce DNA interstrand cross-links (e.g., CDDP, MEL and MMC), microtubule inhibition (e.g.,COL), topoisomerase inhibition (e.g.,CPT-11 and VP-16), DNA synthesis inhibition (e.g., Ara-C, GEM, HU and aphidicolin) or DNA double-strand breaks (e.g., radiation), exacerbated endogenous A3B overexpression (Fig 4A and 4B). Treatment with olaparib alone, a Poly(ADP-ribose) polymerase (PARP) inhibitor, which is known to induce SSBs that are degraded to DSBs during replication [30], also enhanced A3B expression (Fig 4C). On the other hand, the proteasome inhibitor (i.e., BOR), the immunomodulatory drug (i.e., LEN), the non-agonistic antibody drug (i.e., ELO) and INF-α did not enhance A3B expression levels (Fig 4A). These results intimate that DNA toxic stimulation upregulates A3B expression through DDR and following activation of DDR associated phosphatidylinositol 3' kinase-related kinases (DDR-PIKKs) [31] including ataxia telangiectasia and Rad3-related (ATR), and ataxia telangiectasia-mutated (ATM), DNA-dependent protein kinase (DNA-PK). Chemical inhibition of DDR-PIKKs by VE-821 for ATR, or NU-7026 for DNA-PK, suppressed EGFP increase upon antimetabolite treatment (Fig 4D and 4E). Moreover, various combinations of PIKK inhibitors, including KU-55933, an ATM inhibitor, exhibited a synergistic effect of preventing A3B expression increase upon antimetabolite stimulation (Fig 4D and 4E). Notably, pretreatment with CGK733 alone, which was first reported as an ATM/ATR inhibitor [32], almost completely blocked the antimetabolite effect on A3B expression in the three cell lines (Fig 4F). These results suggest that all the DDR-PIKK pathways might be involved in A3B regulation in myeloma cells.
Fig. 4. DNA damage response exacerbates A3B overexpression via the DDR-PIKK pathways in myeloma cells. (A) A panel of EGFP mean fluorescent intensity (MFI) of three A3B–3×FLAG–IRES–EGFP knock-in cell lines with various anti-cancer treatment. A3B reporter cells were incubated for 2 days with each anti-cancer reagent at the concentrations indicated on the horizontal axis. For the UVC exposure experiment, A3B reporter cells were irradiated with a single dose at 2 days before flow cytometry analysis. Hash mark (#) represents unmeasurable state due to cytotoxicity. (B) Bar graph of EGFP MFI of AMO1 KI cells, which were exposed to a single dose of γ-ray at 2 days before flow cytometry analysis. (C) Bar graph of EGFP MFI of three A3B–3×FLAG–IRES–EGFP knock-in cell lines with olaparib treatment (10 μM) for 2 days. (D, E) Histograms (D) and bar graphs (E) of EGFP intensity values from AMO1 KI cells, which were co-treated with HU (1μM) and DDR-PIKK inhibitors: KU-55933, 5 μM; VE-821, 5 μM; NU-7026, 2 μM; CGK733, 5 μM. Cells were incubated with the reagents for 2 days and subsequently analyzed by flow cytometry. Mann-Whitney U tests were performed to compare the results between HU-treated and PIKK inhibitor-treated samples: **P < 0.01; *P < 0.05. (F) Bar graph of EGFP MFI of three A3B–3×FLAG–IRES–EGFP knock-in cell lines treated with an antimetabolite (Ara-C, 50 μM; GEM, 1 μM; HU, 1 μM) with or without CGK733 (5 μM) for 2 days. Mann-Whitney U tests were performed to compare the results between antimetabolite-treated and CGK733-treated sample: **P < 0.01. Discussion
In the present report, we successfully established four A3B reporter cell lines derived from three human myeloma cell lines, U266, RPMI8226 and AMO1. These cell lines express EGFP proteins with attribution to A3B expression, regulated by the same transcriptional/posttranscriptional mechanisms due to identical promoter, 3’-UTR and 5’-UTR to A3B. Due to these particularities, these cell lines are a very useful tool for investigating A3B regulation in a high-throughput screening format by flow cytometry analysis, which will allow for the development of specific A3B suppressors. There are several similar reports of other gene-edited reporter cell lines used for comprehensively studying the transcriptional regulation of the targeted gene [33–37]. In the case of A3B, most previous reports have studied A3B protein function using exogenous overexpression by transient transfection in a limited number of cell lines including non-human cells [16, 26, 38–44], mainly due to the difficulty of obtaining specific anti-A3B antibodies. In contrast, the commercially available and certified anti-FLAG antibody can be used to explore the A3B protein in the established A3B reporter cell lines described here. That is to say, these cell lines have the potential to clarify natural protein-protein and/or DNA-protein interaction of A3B specifically, in tumor cells. In addition, the A3B reporter system can be integrated into other A3B-overexpressing cell lines by using the Cas9/sgRNA #4 expressing vector and pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA vector described here.
According to our pilot screening, most of the conventional anticancer treatments exacerbated A3B overexpression in myeloma cells (Fig 4A and 4B). These treatments seem to act through a common pathway: induction of DDR [45]. Specifically, HU, which inhibits the incorporation of nucleotides by interfering with the enzyme ribonucleotide reductase [46], and APH, which interferes with DNA replication by inhibiting DNA polymerases α, ε and δ [47], are both commonly used to induce replication fork stalling that leads to ATR/ATM activation. These antimetabolites are also known to induce DSBs [48, 49]. CPT-11 covalently stabilizes the topoisomerase I–DNA cleavage complex by inhibiting the ligation of SSBs [50], thereby increasing the number of SSBs and subsequent DSBs [51]. Meanwhile, VP-16 leads to increases in the levels of topoisomerase II–DNA covalent complexes resulting in the rapid induction of DSBs [52]. DNA interstrand cross-linkers form a number of adducts with DNA, and thereafter activate a wide variety of DNA repair pathways [53] such as nucleotide excision repair (NER) [54, 55], homology-directed repair (HDR) [56] and mismatch repair (MMR) [57]. DNA interstrand cross-links are also known to be sensed by non-histone chromosomal high-mobility group box proteins 1 and 2 (HMGB1 and HMGB2), which affect cell cycle events and subsequently induce apoptosis [58]. Colcemid also has the potential to induce DSBs [59, 60]. Although UV exposure dominantly produces cyclobutane pyrimidine dimers (CPDs) and 6–4 photoproducts (6-4PP) but not DSBs directly, it activates ATR by SSBs and ATM by DSBs in a NER-dependent manner [61]. On the other hand, bortezomib and lenalidomide did not enhance A3B overexpression (Fig 4A). We cannot exclude the possibility that these drugs can directly cause DSBs, however, there are few reports of DNA damage induced by a single treatment with bortezomib or lenalidomide.
The upregulation of A3B expression induced by DNA damage was suppressed by DDR-PIKK inhibitors, consistent with a previous report in breast cancer [13]. Under single-inhibition of each DDR-PIKK pathway, the DNA-PK inhibitor (NU-7026) suppressed A3B elevation the strongest. Kanu et al. reported that inhibiting ATR, and to a lesser extent ATM, reduced hydroxyurea-induced A3B activation, and concluded that DNA replication stress activates transcription of A3B via an ATR/Chk1-dependent pathway in breast cancer [13]. Thus, the dependency of A3B regulation on each DDR-PIKK pathway could vary among cancer cell types. On closer examination of the histograms in our study, EGFP signal curves from cells treated with NU-7026 had two peaks in contrast to those treated with VE-821 which had only one peak (Fig 4D), suggesting that DNA-PK inhibition completely blocked A3B upregulation in a certain population of cells, whereas ATR inhibition suppressed it in all cells. Considering the synergistic effects of the combinations of DDR-PIKK inhibitors in our study (Fig 4D and 4E), it seems that all the DDR-PIKK pathways are at least partly involved in A3B regulation in myeloma cells. This model is also supported by the redundancy between DDR-PIKK pathways under DNA replication stress [62]. Interestingly, A3B induction by DDR was almost completely blocked by treatment with CGK733 alone. CGK733 was initially reported to inhibit both ATM and ATR kinase activities, however, its specificity is now considered controversial [63, 64]. Nonetheless, there seems to be no doubt that CGK733 targets at least partly a downstream factor of the ATM/ATR pathway [65, 66]. HMGB1 and Cdc7 were identified as new target kinase candidates of CGK733 [67]. Of note, proteasome inhibitors were reported to suppress DDR by inhibiting phosphorylation of DDR-PIKKs [68, 69]. This suppression effect could explain why bortezomib did not exacerbate A3B expression.
We previously reported that shRNA against A3B decreased the basal level of γH2AX foci in myeloma cell lines, indicating that A3B induces constitutive DNA double-strand breaks, promoting DDR activation [7]. Therefore DDR-inducible treatments trigger a positive feedback loop for A3B expression, which may drive chemoresistant clone expansion during chemotherapy. To prevent disease progression and potentiate current therapy, conventional anticancer treatment coupled with a combination of DDR-PIKK inhibitors including a proteasome inhibitor might not only have a synergistic cytotoxicity for tumor cells but also suppress the production of chemoresistant clones.
Supporting information
S1 Fig [pdf]
Original membranes and gels.S1 Table [xlsx]
List of oligos and thermal cycle conditions for genotyping PCR.S2 Table [xlsx]
sgRNA target candidates for A3B.
Zdroje
1. Henderson S, Fenton T. APOBEC3 genes: retroviral restriction factors to cancer drivers. Trends in molecular medicine. 2015;21(5):274–84. doi: 10.1016/j.molmed.2015.02.007 25820175
2. Alexandrov LB, Nik-Zainal S, Wedge DC, Aparicio SA, Behjati S, Biankin AV, et al. Signatures of mutational processes in human cancer. Nature. 2013;500(7463):415–21. doi: 10.1038/nature12477 23945592
3. Swanton C, McGranahan N, Starrett GJ, Harris RS. APOBEC Enzymes: Mutagenic Fuel for Cancer Evolution and Heterogeneity. Cancer Discov. 2015;5(7):704–12. doi: 10.1158/2159-8290.CD-15-0344 26091828
4. Gao J, Choudhry H, Cao W. Apolipoprotein B mRNA editing enzyme catalytic polypeptide-like family genes activation and regulation during tumorigenesis. Cancer science. 2018;109(8):2375–82. doi: 10.1111/cas.13658 29856501
5. Walker BA, Wardell CP, Murison A, Boyle EM, Begum DB, Dahir NM, et al. APOBEC family mutational signatures are associated with poor prognosis translocations in multiple myeloma. Nat Commun. 2015;6 : 6997. doi: 10.1038/ncomms7997 25904160
6. Maura F, Petljak M, Lionetti M, Cifola I, Liang W, Pinatel E, et al. Biological and prognostic impact of APOBEC-induced mutations in the spectrum of plasma cell dyscrasias and multiple myeloma cell lines. Leukemia. 2018;32(4):1044–8. doi: 10.1038/leu.2017.345 29209044
7. Yamazaki H, Shirakawa K, Matsumoto T, Hirabayashi S, Murakawa Y, Kobayashi M, et al. Endogenous APOBEC3B Overexpression Constitutively Generates DNA Substitutions and Deletions in Myeloma Cells. Scientific reports. 2019;9(1).
8. Sieuwerts AM, Willis S, Burns MB, Look MP, Meijer-Van Gelder ME, Schlicker A, et al. Elevated APOBEC3B correlates with poor outcomes for estrogen-receptor-positive breast cancers. Hormones & cancer. 2014;5(6):405–13.
9. Law EK, Sieuwerts AM, LaPara K, Leonard B, Starrett GJ, Molan AM, et al. The DNA cytosine deaminase APOBEC3B promotes tamoxifen resistance in ER-positive breast cancer. Science advances. 2016;2(10):e1601737. doi: 10.1126/sciadv.1601737 27730215
10. Yan S, He F, Gao B, Wu H, Li M, Huang L, et al. Increased APOBEC3B Predicts Worse Outcomes in Lung Cancer: A Comprehensive Retrospective Study. J Cancer. 2016;7(6):618–25. doi: 10.7150/jca.14030 27076842
11. Du Y, Tao X, Wu J, Yu H, Yu Y, Zhao H. APOBEC3B up-regulation independently predicts ovarian cancer prognosis: a cohort study. Cancer Cell Int. 2018;18 : 78. doi: 10.1186/s12935-018-0572-5 29853799
12. Ng JCF, Quist J, Grigoriadis A, Malim MH, Fraternali F. Pan-cancer transcriptomic analysis dissects immune and proliferative functions of APOBEC3 cytidine deaminases. Nucleic acids research. 2019.
13. Kanu N, Cerone MA, Goh G, Zalmas LP, Bartkova J, Dietzen M, et al. DNA replication stress mediates APOBEC3 family mutagenesis in breast cancer. Genome biology. 2016;17(1):185. doi: 10.1186/s13059-016-1042-9 27634334
14. Shimizu A, Fujimori H, Minakawa Y, Matsuno Y, Hyodo M, Murakami Y, et al. Onset of deaminase APOBEC3B induction in response to DNA double-strand breaks. Biochem Biophys Rep. 2018;16 : 115–21. doi: 10.1016/j.bbrep.2018.10.010 30417129
15. Vieira VC, Leonard B, White EA, Starrett GJ, Temiz NA, Lorenz LD, et al. Human papillomavirus E6 triggers upregulation of the antiviral and cancer genomic DNA deaminase APOBEC3B. mBio. 2014;5(6).
16. Mori S, Takeuchi T, Ishii Y, Kukimoto I. Identification of APOBEC3B promoter elements responsible for activation by human papillomavirus type 16 E6. Biochem Biophys Res Commun. 2015;460(3):555–60. doi: 10.1016/j.bbrc.2015.03.068 25800874
17. Leonard B, McCann JL, Starrett GJ, Kosyakovsky L, Luengas EM, Molan AM, et al. The PKC/NF-kappaB signaling pathway induces APOBEC3B expression in multiple human cancers. Cancer Res. 2015;75(21):4538–47. doi: 10.1158/0008-5472.CAN-15-2171-T 26420215
18. Maruyama W, Shirakawa K, Matsui H, Matsumoto T, Yamazaki H, Sarca AD, et al. Classical NF-kappaB pathway is responsible for APOBEC3B expression in cancer cells. Biochem Biophys Res Commun. 2016;478(3):1466–71. doi: 10.1016/j.bbrc.2016.08.148 27577680
19. Chou WC, Chen WT, Hsiung CN, Hu LY, Yu JC, Hsu HM, et al. B-Myb Induces APOBEC3B Expression Leading to Somatic Mutation in Multiple Cancers. Scientific reports. 2017;7 : 44089. doi: 10.1038/srep44089 28276478
20. Naito Y, Hino K, Bono H, Ui-Tei K. CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics (Oxford, England). 2015;31(7):1120–3.
21. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature protocols. 2013;8(11):2281–308. doi: 10.1038/nprot.2013.143 24157548
22. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science (New York, NY). 2014;343(6166):84–7.
23. Guschin DY, Waite AJ, Katibah GE, Miller JC, Holmes MC, Rebar EJ. A rapid and general assay for monitoring endogenous gene modification. Methods in molecular biology (Clifton, NJ). 2010;649 : 247–56.
24. Blum R, Pfeiffer F, Feick P, Nastainczyk W, Kohler B, Schafer KH, et al. Intracellular localization and in vivo trafficking of p24A and p23. Journal of cell science. 1999;112 (Pt 4):537–48.
25. Salomonis N, Schlieve CR, Pereira L, Wahlquist C, Colas A, Zambon AC, et al. Alternative splicing regulates mouse embryonic stem cell pluripotency and differentiation. Proc Natl Acad Sci U S A. 2010;107(23):10514–9. doi: 10.1073/pnas.0912260107 20498046
26. Burns MB, Lackey L, Carpenter MA, Rathore A, Land AM, Leonard B, et al. APOBEC3B is an enzymatic source of mutation in breast cancer. Nature. 2013;494(7437):366–70. doi: 10.1038/nature11881 23389445
27. Hellman NE, Spector J, Robinson J, Zuo X, Saunier S, Antignac C, et al. Matrix metalloproteinase 13 (MMP13) and tissue inhibitor of matrix metalloproteinase 1 (TIMP1), regulated by the MAPK pathway, are both necessary for Madin-Darby canine kidney tubulogenesis. The Journal of biological chemistry. 2008;283(7):4272–82. doi: 10.1074/jbc.M708027200 18039671
28. Eggenschwiler R, Loya K, Wu G, Sharma AD, Sgodda M, Zychlinski D, et al. Sustained knockdown of a disease-causing gene in patient-specific induced pluripotent stem cells using lentiviral vector-based gene therapy. Stem cells translational medicine. 2013;2(9):641–54. doi: 10.5966/sctm.2013-0017 23926210
29. Kanda Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone marrow transplantation. 2013;48(3):452–8. doi: 10.1038/bmt.2012.244 23208313
30. Li M, Yu X. The role of poly(ADP-ribosyl)ation in DNA damage response and cancer chemotherapy. Oncogene. 2015;34(26):3349–56. doi: 10.1038/onc.2014.295 25220415
31. Blackford AN, Jackson SP. ATM, ATR, and DNA-PK: The Trinity at the Heart of the DNA Damage Response. Molecular cell. 2017;66(6):801–17. doi: 10.1016/j.molcel.2017.05.015 28622525
32. Won J, Kim M, Kim N, Ahn JH, Lee WG, Kim SS, et al. Small molecule-based reversible reprogramming of cellular lifespan. Nature chemical biology. 2006;2(7):369–74. doi: 10.1038/nchembio800 16767085
33. Cho YS, Kim BS, Sim CK, Kim I, Lee MS. Establishment of IL-7 Expression Reporter Human Cell Lines, and Their Feasibility for High-Throughput Screening of IL-7-Upregulating Chemicals. PLoS One. 2016;11(9):e0161899. doi: 10.1371/journal.pone.0161899 27589392
34. Shan L, Wang D, Mao Q, Xia H. Establishment of a DGKtheta Endogenous Promoter Luciferase Reporter HepG2 Cell Line for Studying the Transcriptional Regulation of DGKtheta Gene. Applied biochemistry and biotechnology. 2019;187(4):1344–55. doi: 10.1007/s12010-018-2890-4 30229432
35. Li Z, Zhao J, Muhammad N, Wang D, Mao Q, Xia H. Establishment of a HEK293 cell line by CRISPR/Cas9-mediated luciferase knock-in to study transcriptional regulation of the human SREBP1 gene. Biotechnology letters. 2018;40(11–12):1495–506. doi: 10.1007/s10529-018-2608-2 30232659
36. Veach RA, Wilson MH. CRISPR/Cas9 engineering of a KIM-1 reporter human proximal tubule cell line. PLoS One. 2018;13(9):e0204487. doi: 10.1371/journal.pone.0204487 30260998
37. Li Y, Li S, Li Y, Xia H, Mao Q. Generation of a novel HEK293 luciferase reporter cell line by CRISPR/Cas9-mediated site-specific integration in the genome to explore the transcriptional regulation of the PGRN gene. Bioengineered. 2019;10(1):98–107. doi: 10.1080/21655979.2019.1607126 31023186
38. Shinohara M, Io K, Shindo K, Matsui M, Sakamoto T, Tada K, et al. APOBEC3B can impair genomic stability by inducing base substitutions in genomic DNA in human cells. Scientific reports. 2012;2 : 806. doi: 10.1038/srep00806 23150777
39. Taylor BJ, Nik-Zainal S, Wu YL, Stebbings LA, Raine K, Campbell PJ, et al. DNA deaminases induce break-associated mutation showers with implication of APOBEC3B and 3A in breast cancer kataegis. Elife. 2013;2:e00534. doi: 10.7554/eLife.00534 23599896
40. Akre MK, Starrett GJ, Quist JS, Temiz NA, Carpenter MA, Tutt AN, et al. Mutation Processes in 293-Based Clones Overexpressing the DNA Cytosine Deaminase APOBEC3B. PLoS One. 2016;11(5):e0155391. doi: 10.1371/journal.pone.0155391 27163364
41. Hoopes JI, Cortez LM, Mertz TM, Malc EP, Mieczkowski PA, Roberts SA. APOBEC3A and APOBEC3B Preferentially Deaminate the Lagging Strand Template during DNA Replication. Cell Rep. 2016;14(6):1273–82. doi: 10.1016/j.celrep.2016.01.021 26832400
42. Zhang W, Zhang X, Tian C, Wang T, Sarkis PT, Fang Y, et al. Cytidine deaminase APOBEC3B interacts with heterogeneous nuclear ribonucleoprotein K and suppresses hepatitis B virus expression. Cellular microbiology. 2008;10(1):112–21. doi: 10.1111/j.1462-5822.2007.01020.x 17672864
43. Xiao X, Yang H, Arutiunian V, Fang Y, Besse G, Morimoto C, et al. Structural determinants of APOBEC3B non-catalytic domain for molecular assembly and catalytic regulation. Nucleic acids research. 2017;45(12):7494–506. doi: 10.1093/nar/gkx362 28575276
44. Mishra N, Reddy KS, Timilsina U, Gaur D, Gaur R. Human APOBEC3B interacts with the heterogenous nuclear ribonucleoprotein A3 in cancer cells. Journal of cellular biochemistry. 2018;119(8):6695–703. doi: 10.1002/jcb.26855 29693745
45. Vesela E, Chroma K, Turi Z, Mistrik M. Common Chemical Inductors of Replication Stress: Focus on Cell-Based Studies. Biomolecules. 2017;7(1).
46. Krakoff IH, Brown NC, Reichard P. Inhibition of ribonucleoside diphosphate reductase by hydroxyurea. Cancer Res. 1968;28(8):1559–65. 4876978
47. Cheng CH, Kuchta RD. DNA polymerase epsilon: aphidicolin inhibition and the relationship between polymerase and exonuclease activity. Biochemistry. 1993;32(33):8568–74. doi: 10.1021/bi00084a025 8395209
48. Saintigny Y, Delacote F, Vares G, Petitot F, Lambert S, Averbeck D, et al. Characterization of homologous recombination induced by replication inhibition in mammalian cells. The EMBO journal. 2001;20(14):3861–70. doi: 10.1093/emboj/20.14.3861 11447127
49. Ewald B, Sampath D, Plunkett W. H2AX phosphorylation marks gemcitabine-induced stalled replication forks and their collapse upon S-phase checkpoint abrogation. Molecular cancer therapeutics. 2007;6(4):1239–48. doi: 10.1158/1535-7163.MCT-06-0633 17406032
50. Staker BL, Hjerrild K, Feese MD, Behnke CA, Burgin AB Jr., Stewart L. The mechanism of topoisomerase I poisoning by a camptothecin analog. Proc Natl Acad Sci U S A. 2002;99(24):15387–92. doi: 10.1073/pnas.242259599 12426403
51. Tuduri S, Crabbe L, Conti C, Tourriere H, Holtgreve-Grez H, Jauch A, et al. Topoisomerase I suppresses genomic instability by preventing interference between replication and transcription. Nature cell biology. 2009;11(11):1315–24. doi: 10.1038/ncb1984 19838172
52. Nitiss JL. Targeting DNA topoisomerase II in cancer chemotherapy. Nature reviews Cancer. 2009;9(5):338–50. doi: 10.1038/nrc2607 19377506
53. Dronkert ML, Kanaar R. Repair of DNA interstrand cross-links. Mutation research. 2001;486(4):217–47. doi: 10.1016/s0921-8777(01)00092-1 11516927
54. Koberle B, Masters JR, Hartley JA, Wood RD. Defective repair of cisplatin-induced DNA damage caused by reduced XPA protein in testicular germ cell tumours. Current biology: CB. 1999;9(5):273–6. doi: 10.1016/s0960-9822(99)80118-3 10074455
55. Damsma GE, Alt A, Brueckner F, Carell T, Cramer P. Mechanism of transcriptional stalling at cisplatin-damaged DNA. Nat Struct Mol Biol. 2007;14(12):1127–33. doi: 10.1038/nsmb1314 17994106
56. Borst P, Rottenberg S, Jonkers J. How do real tumors become resistant to cisplatin? Cell cycle (Georgetown, Tex). 2008;7(10):1353–9.
57. Sedletska Y, Fourrier L, Malinge JM. Modulation of MutS ATP-dependent functional activities by DNA containing a cisplatin compound lesion (base damage and mismatch). Journal of molecular biology. 2007;369(1):27–40. doi: 10.1016/j.jmb.2007.02.048 17400248
58. Brown R, Clugston C, Burns P, Edlin A, Vasey P, Vojtesek B, et al. Increased accumulation of p53 protein in cisplatin-resistant ovarian cell lines. International journal of cancer. 1993;55(4):678–84. doi: 10.1002/ijc.2910550428 8406999
59. Hayashi MT, Cesare AJ, Fitzpatrick JA, Lazzerini-Denchi E, Karlseder J. A telomere-dependent DNA damage checkpoint induced by prolonged mitotic arrest. Nat Struct Mol Biol. 2012;19(4):387–94. doi: 10.1038/nsmb.2245 22407014
60. Li H, Chang TW, Tsai YC, Chu SF, Wu YY, Tzang BS, et al. Colcemid inhibits the rejoining of the nucleotide excision repair of UVC-induced DNA damages in Chinese hamster ovary cells. Mutation research. 2005;588(2):118–28. doi: 10.1016/j.mrgentox.2005.09.005 16290038
61. Wakasugi M, Sasaki T, Matsumoto M, Nagaoka M, Inoue K, Inobe M, et al. Nucleotide excision repair-dependent DNA double-strand break formation and ATM signaling activation in mammalian quiescent cells. The Journal of biological chemistry. 2014;289(41):28730–7. doi: 10.1074/jbc.M114.589747 25164823
62. Stiff T, Walker SA, Cerosaletti K, Goodarzi AA, Petermann E, Concannon P, et al. ATR-dependent phosphorylation and activation of ATM in response to UV treatment or replication fork stalling. The EMBO journal. 2006;25(24):5775–82. doi: 10.1038/sj.emboj.7601446 17124492
63. Choi S, Toledo LI, Fernandez-Capetillo O, Bakkenist CJ. CGK733 does not inhibit ATM or ATR kinase activity in H460 human lung cancer cells. DNA repair. 2011;10(10):1000–1; author reply 2. doi: 10.1016/j.dnarep.2011.07.013 21865098
64. Williams TM, Nyati S, Ross BD, Rehemtulla A. Molecular imaging of the ATM kinase activity. Int J Radiat Oncol Biol Phys. 2013;86(5):969–77. doi: 10.1016/j.ijrobp.2013.04.028 23726004
65. Fallone F, Britton S, Nieto L, Salles B, Muller C. ATR controls cellular adaptation to hypoxia through positive regulation of hypoxia-inducible factor 1 (HIF-1) expression. Oncogene. 2013;32(37):4387–96. doi: 10.1038/onc.2012.462 23085754
66. Bhattacharya S, Ray RM, Johnson LR. Role of polyamines in p53-dependent apoptosis of intestinal epithelial cells. Cellular signalling. 2009;21(4):509–22. doi: 10.1016/j.cellsig.2008.12.003 19136059
67. Suzuki T, Tsuzuku J, Hayashi A, Shiomi Y, Iwanari H, Mochizuki Y, et al. Inhibition of DNA damage-induced apoptosis through Cdc7-mediated stabilization of Tob. The Journal of biological chemistry. 2012;287(48):40256–65. doi: 10.1074/jbc.M112.353805 23066029
68. Sakasai R, Teraoka H, Tibbetts RS. Proteasome inhibition suppresses DNA-dependent protein kinase activation caused by camptothecin. DNA repair. 2010;9(1):76–82. doi: 10.1016/j.dnarep.2009.10.008 19959400
69. Jacquemont C, Taniguchi T. Proteasome function is required for DNA damage response and fanconi anemia pathway activation. Cancer Res. 2007;67(15):7395–405. doi: 10.1158/0008-5472.CAN-07-1015 17671210
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
Článok vyšiel v časopisePLOS One
Najčítanejšie tento týždeň
2020 Číslo 1- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Nejasný stín na plicích – kazuistika
- Kombinace metamizol/paracetamol v léčbě pooperační bolesti u zákroků v rámci jednodenní chirurgie
- Masturbační chování žen v ČR − dotazníková studie
- Eliquis (apixaban) nově hrazen ze zdravotního pojištění
-
Všetky články tohto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- In vivo elongation of thin filaments results in heart failure
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- Efficient processing of raster and vector data
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- Dome-shaped macula in children and adolescents
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Exploring the impact of terminology differences in blood and organ donor decision making
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- Human-raptor conflict in rural settlements of Colombia
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- Psychometric validation of Czech version of the Sport Motivation Scale
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy