-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
Authors: Gayle P. Pouliot aff001; James Degar aff001; Laura Hinze aff001; Bose Kochupurakkal aff003; Chau D. Vo aff001; Melissa A. Burns aff001; Lisa Moreau aff001; Chirag Ganesa aff003; Justine Roderick aff004; Sofie Peirs aff005; Bjorn Menten aff005; Mignon L. Loh aff006; Stephen P. Hunger aff007; Lewis B. Silverman aff001; Marian H. Harris aff008; Kristen E. Stevenson aff009; David M. Weinstock aff010; Andrew P. Weng aff011; Pieter Van Vlierberghe aff005; Alan D. D’Andrea aff001; Alejandro Gutierrez aff001
Authors place of work: Division of Hematology/Oncology, Boston Children’s Hospital, Boston, Massachusetts, United States of America aff001; Department of Pediatric Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts, United States of America aff002; Center for DNA Damage and Repair and Department of Radiation Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts, United States of America aff003; Department of Molecular, Cell and Cancer Biology, University of Massachusetts Medical School, Worcester, Massachusetts, United States of America aff004; Department of Biomolecular Medicine, Ghent University, Ghent, Belgium aff005; Department of Pediatrics, University of California San Francisco, San Francisco, California, United States of America aff006; Division of Oncology and the Center for Childhood Cancer Research, The Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania, United States of America aff007; Department of Pathology, Boston Children’s Hospital, Boston, Massachusetts, United States of America aff008; Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, Massachusetts, United States of America aff009; Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts, United States of America aff010; Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, British Columbia, Canada aff011
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0221288Summary
BRCA2 (also known as FANCD1) is a core component of the Fanconi pathway and suppresses transformation of immature T-cells in mice. However, the contribution of Fanconi-BRCA pathway deficiency to human T-cell acute lymphoblastic leukemia (T-ALL) remains undefined. We identified point mutations in 9 (23%) of 40 human T-ALL cases analyzed, with variant allele fractions consistent with heterozygous mutations early in tumor evolution. Two of these mutations were present in remission bone marrow specimens, suggesting germline alterations. BRCA2 was the most commonly mutated gene. The identified Fanconi-BRCA mutations encode hypomorphic or null alleles, as evidenced by their inability to fully rescue Fanconi-deficient cells from chromosome breakage, cytotoxicity and/or G2/M arrest upon treatment with DNA cross-linking agents. Disabling the tumor suppressor activity of the Fanconi-BRCA pathway is generally thought to require biallelic gene mutations. However, all mutations identified were monoallelic, and most cases appeared to retain expression of the wild-type allele. Using isogenic T-ALL cells, we found that BRCA2 haploinsufficiency induces selective hypersensitivity to ATR inhibition, in vitro and in vivo. These findings implicate Fanconi-BRCA pathway haploinsufficiency in the molecular pathogenesis of T-ALL, and provide a therapeutic rationale for inhibition of ATR or other druggable effectors of homologous recombination.
Keywords:
Mutation – Point mutation – Polymerase chain reaction – Genetic causes of cancer – Gene sequencing – Haploinsufficiency – Dideoxy DNA sequencing
Introduction
The Fanconi pathway functions in the repair of DNA inter-strand crosslinks and stalled replication forks [1]. Stalled replication forks trigger activation of the upstream Fanconi complex (or Fanconi complex 1), which ubiquitinates FANCD2. FANCD2 ubiquitination promotes the formation of the downstream Fanconi complex (complex 2), which mediates subsequent DNA repair. Biallelic germline mutations of any Fanconi genes including BRCA2 cause Fanconi anemia, a syndrome characterized by developmental anomalies, bone marrow failure, and a predisposition to acute myeloid leukemia and squamous cell carcinomas [1].
The study of rare genetic cancer predisposition syndromes has revealed fundamental insights into the pathobiology of sporadic oncogenesis in the general population. For example, familial adenomatous polyposis, a clinical syndrome associated with highly penetrant colorectal adenocarcinomas [2], is caused by germline mutations of APC [3–5]. Although familial adenomatous polyposis accounts for only a small fraction of colorectal cancers in the general population, APC gene mutations are the most common genetic alteration in sporadic colorectal adenocarcinomas [3, 6]. Likewise, germline monoallelic mutations of BRCA1 and BRCA2 cause familial breast and ovarian cancer predisposition syndromes [7, 8], and these genes are recurrently mutated in sporadic breast and ovarian cancers [9, 10]. While germline or somatic mutations of these and other Fanconi genes, including upstream Fanconi genes such as FANCM, have been linked to several tumor types, these are most often carcinomas [9–15]. Given that the pathobiology of sporadic cancers is shared with that of genetic cancer predisposition syndromes across numerous tumor types, the paucity of Fanconi-BRCA mutations reported in sporadic human leukemias would appear to be discordant with the high incidence of leukemia in patients with Fanconi anemia [16].
Brca2-deficient mice spontaneously develop T-lymphoblastic malignancies at high frequency [17, 18], and these tumors also occur in Fancc-deficient mice [19]. Furthermore, several case reports have described T-lymphoblastic malignancies in individuals with germline mutations of the Fanconi-BRCA pathway [20–24]. However, the degree to which this pathway plays a role in human T-cell leukemogenesis remains unclear. Here, we report a high frequency of loss-of-function mutations of Fanconi-BRCA pathway genes in childhood T-ALL. All mutations identified were monoallelic, and most of these cases retained expression of the wild-type allele, suggesting partial rather than complete Fanconi-BRCA pathway inactivation. Despite the clinical benefit of PARP inhibitors in tumors with complete Fanconi-BRCA pathway inactivation [25, 26], this approach appears to have little efficacy against tumors with monoallelic BRCA gene mutations [27]. However, we found that BRCA2 haploinsufficient cells are hypersensitive to ATR inhibition, in vitro and in vivo. Thus, BRCA haploinsufficiency may represent a targetable pathogenic alteration in T-ALL.
Materials and methods
Patient samples
The primary cohort of T-ALL diagnostic samples consisted of 40 specimens collected from children with newly diagnosed T-ALL who were enrolled on Dana-Farber Cancer Institute Study 05–001 between April 2005 and February 2010 (https://clinicaltrials.gov/ct2/show/NCT00400946), or Children’s Oncology Group Study AALL0434 between January 2007 and June 2014 (https://clinicaltrials.gov/ct2/show/NCT00408005). The validation cohort consistent of a distinct 69 pediatric T-ALL patient samples collected from children on Dana-Farber Cancer Institute Study 05–001 over the same time period. All samples were obtained prior to the initiation of chemotherapy. Samples were purified using Ficoll-Paque reagent, and cells were viably frozen. All samples were collected with written informed consent and Institutional Review Board (IRB) approval of the respective institutions, in accordance with the Declaration of Helsinki.
Targeted exon sequencing of T-ALL patient samples
Targeted exon sequencing for all protein-coding exons of the genes listed in S1 Table was performed using the customized Dana-Farber OncoPanel massively parallel sequencing assay as described [28]. Briefly, DNA was isolated using the AllPrep DNA/RNA Mini Kit (OPv1 cohort, Qiagen, Venlo, The Netherlands) or the DNeasy kit (OPv3mod cohort; Qiagen) according to manufracturer’s instructions and DNA concentration analyzed using PicoGreen. DNA library preparation and hybrid capture were performed as described [28], and samples were sequenced on an Illumina HISeq 2500. Pooled sample reads were de-convoluted and sorted using Picard tools (https://github.com/broadinstitute/picard), and aligned to the human genome using build 37 edition from the Human Genome Reference Consortium, as described [28]. Mutation analysis for single nucleotide variants (SNV sheet in S3 Table) was performed using MuTect v1.1.4. Analysis for insertions/deletions (INDEL sheet in S3 Table) was performed using the SomaticIndelDetector tool. Analysis for multiple CNVs in the same codon was performed using the GATK ReadBackPhasing Tool (PHASED sheet in S3 Table), as described [29]. The Best Effect single nucleotide variant (SNV) and indel data were then filtered using the 6,500 exome release of the Exome Sequencing Project (ESP) database and queried against dbSNP and COSMIC database. Fanconi-BRCA pathway genes sequenced included FANCA, FANCC, FANCE, FANCF and FANCG, BRCA2/FANCD1, FANCD2, BRIP1/FANCJ, PALB2/FANCN, and ERCC4/FANCQ. BRCA1, which has recently been shown to also be a Fanconi gene [30], was also sequenced.
Mutation calls were made for mutations with an allele fraction ≥ 0.3, and the mutation was predicted to result in a non-synonymous amino acid alteration, or predicted to disrupt a start codon, stop codon, or splice site. Mutations were excluded if they were present at any frequency in dbSNP or in the Exome Variant Server, NHLBI GO Exome Sequencing (http://evs.gs.washington.edu/EVS/) at the time of analysis. Data from targeted exon sequencing and RNA sequencing of primary T-ALL patient samples is available in the dbGap controlled-access database (https://www.ncbi.nlm.nih.gov/gap), study ID: phs001513, which is accessible to users with the appropriate institutional certifications for human subject projections.
Array CGH analysis of T-ALL patient samples
All samples analyzed by targeted exon sequencing in the primary cohort that had sufficient material available (n = 36 of 40 in OPv1 cohort) were also profiled for DNA copy number analysis using SurePrint G3 Human 4×180K CGH Microarrays (Agilent Technologies, Santa Clara, CA). Patient and control genomic DNAs (gDNAs) were labeled with Cy3 and Cy5 dyes (PerkinElmer, Waltham, MA) and hybridization was performed according to the manufacturer’s instructions (Agilent Technologies), followed by data-analysis using the arrayCGHbase tool [31]. Segmentation was performed with the BioConductor DNAcopy package (http://www.bioconductor.org/packages/2.2/bioc/html/DNAcopy.html), as previously described [32]. Log2 copy number ratio for heterozygous deletion was defined as -0.5 to -1.5 (corresponding to 35–70% of normal copy number), and log2 copy number ratio for homozygous deletion was defined as less than -1.5 (corresponding to <35% of normal copy number). Log2 copy number ratio for duplication was 0.32 to 0.81 (corresponding to 25 to 75% of normal copy number), and Log2 copy number ratios greater than 0.81 were considered amplification. Array CGH data are available in the NCBI Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/) as GSE96624.
Sanger sequencing
For Sanger sequencing of genomic DNA, PCR amplification of the region of interest surrounding each mutation was performed using the OneTaq Hot Start kit (Qiagen, Hilden, Germany) with the forward (F) and reverse (R) primers listed in S6 Table. PCR products were then purified using the QIAquick PCR purification kit (Qiagen) and sent for sequencing with the sequencing primers listed at S6 Table.
For sequencing of the cDNA, RNA was isolated from the samples using the AllPrep Kit (Qiagen) as above, treated with DNase I (Thermo Fisher, Waltham, MA), and then used for cDNA synthesis using the SuperScript III First-Strand Synthesis System (Thermo Fisher). The cDNA product was then used for PCR amplification with the primers listed in S6 Table using the OneTaq Hot Start kit (Qiagen). The PCR product was purified using QIAquick PCR purification kit (Qiagen) and sent for sequencing. Sanger sequencing was performed by Genewiz (South Plainfield, NJ).
Patient derived xenografts
Viable T-ALL blasts collected from children with T-ALL were engrafted and expanded in immunodeficient mice, as described [33]. Cells were cultured in alpha-minimum essential media supplemented with 10% FBS, 10% human AB serum (Invitrogen), 1% L-glutamine, 1% penicillin/streptomycin in the presence of recombinant human cytokines stem cell factor (50 ng/ml), Flt3-L (20 ng/ml) and interleukin-7 (10 ng/ml; R&D Systems, Minneapolis, MN, USA) at 37 °C under 5% CO2. All mouse experiments were approved by the Boston Children’s Hospital Institutional Animal Care and Use Committee, and performed in accordance with all regulations.
Fanconi deficient cell lines
The following Fanconi deficient cell lines were used: VU423 (also known as EUFA423) cells, which harbor compound heterozygous BRCA2 inactivating mutations [34]; PD20 cells, which harbor compound heterozygous FANCD2 inactivating mutations [35]; GM6914 cells, which are FANCA deficient [36]; PD331 cells, which are FANCC deficient [37]; EUFA121.L cells, which have compound heterozygous inactivating mutations of FANCF [38]; and HSC 563.L cells, which are deficient for FANCE. All cell lines were obtained from the Alan D’Andrea laboratory or the Oregon Health Sciences University Fanconi Anemia Cell Repository (http://www.ohsu.edu/research/fanconi-anemia/celllines.cfm). EUFA 121.L cells were cultured in RPMI with 15% FBS with 1% penicillin and streptomycin (P/S). VU423, GM6914, PD20 and PD331 cells were cultured in DMEM with 10% FBS with 1% P/S.
Fanconi expression constructs and site-directed mutagenesis
A pcDNA3 plasmid was used to drive expression of wild-type BRCA2 and G418 resistance. A PMMP retroviral vector was used to drive expression of FANCD2, FANCA, FANCC, or FANCF and puromycin resistance. Site-directed mutagenesis was performed on the wild-type plasmids to generate expression constructs encoding each of the T-ALL-associated mutations shown, using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) and the primers in S6 Table. All plasmids were Sanger sequenced to confirm correct introduction of the patient-derived mutations.
Lentiviral and retroviral production and transduction of cell lines
Viral particles for PMMP-driven expression constructs for FANCD2, FANCA, FANCC, or FANCF were generated by co-transfecting these plasmids into HEK 293T cells together with packaging plasmids pMD and p-CMV-VSV-G using Fugene 6 (Promega, Madison, WI). Lentiviruses were generated by co-transfecting pLenti CMV Puro DEST plasmid with packaging vectors psPAX2 (https://www.addgene.org/12260/) and pMD2.G (https://www.addgene.org/12259/) using Fugene (Promega, Madison, WI). The appropriate Fanconi-deficient cell lines were infected with each of the wild-type and point mutant constructs for that gene by incubating cells for 24 hours in virus-containing supernatant in the presence of polybrene at 8 μg/mL. Controls were pcDNA3-Luciferase (control for BRCA2), or PMMP empty vector (FANCD2, FANCA, FANCC, FANCF). Selection was with G418 (BRCA2) or puromycin (FANCD2, FANCA, FANCC, FANCF) at 2 μg/ml beginning 48 hours after infection for at least 72 hours.
The BRCA2 coding sequence is too large for standard viral packaging, so cells were transfected with pcDNA3 constructs encoding wild-type or mutant BRCA2, or Luciferase control, using Lipofectamine 2000 (Thermo Fisher Scientific). Selection for successfully transfected cells was with G418 treatment at 500 μg/ml beginning 48 hours after transfection and continuing for a minimum of 10 days.
Quantitative Reverse Transcriptase PCR and primers
RNA was isolated from cells transduced with the indicated constructs using the RNeasy kit (Qiagen), and cDNA was synthesized using the SuperScript III First-Strand Synthesis System using the oligo(dT)20 primers provided (Thermo Fisher Scientific). Q-RT-PCR was performed using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) and a 7500 Real-Time PCR system (Applied Biosystems) using the primers for each target gene in listed in S6 Table. Beta-actin was the control, and relative gene expression was calculated using the ΔΔCt method.
Western Blotting
Cells were lysed with 10 mM HEPES pH 8.0, 8 M Urea, 1% CHAPS, 150 mM NaCl, 1 mM EDTA, 10 mM glycine supplemented with protease cocktail inhibitor (Roche), resolved by NuPAGE (Invitrogen) gels (NuPAGE 4–12% Bis-Tris for FANCA, FANCC, FANCD2 and FANCF and NuPAGE Tris-Acetate 3–8% for BRCA2) and transferred onto nitrocellulose membrane. The following antibodies were used, FANCA (Bethyl Labs), FANCC (ID#3831, OHSU, Fanconi Anemia Antibody Project, Portland, OR, USA), BRCA2/FANCD1-1 (D0405, OHSU, Fanconi Anemia Antibody Project, Portland, OR, USA), FANCD2 (SC-20022, Santa Cruz, Dallas, TX, USA) FANCF (ab47624m, Abcam, Cambridge, MA, USA), beta-Actin (Cell Signaling Technologies, Danvers, MA, USA). Secondary antibodies were anti-mouse IgG, HRP-linked Antibody and anti-rabbit IgG, HRP-linked antibody (Cell Signaling Technologies, Danvers, MA, USA). Detection was with Supersignal™ West Pico PLUS chemiluminescent Substrate (Thermo Scientific, Waltham, MA,USA) using the Amersham Imager 600 (GE Healthcare Life Sciences).
Mitomycin C complementation assays
Mitomycin C was obtained from Sigma-Aldrich (St. Louis, MO) and dissolved in water. For chromosomal breakage assays, cells were plated at 5 million cells/10 ml of media. Cells were treated with mitomycin C (20 ng/ml) or vehicle control (water) for 48 hours at 37°C with 5% CO2, at which time colcemid was added to final concentration of 100 ng/mL for 1 hour. Adherent cells were trypsinized and incubated in 10 ml hypotonic 0.075 M KCl for 20 minutes. Two ml of methanol:acetic acid (3 : 1) was added to each sample, samples were centrifuged at 500 g x 10 minutes, and supernatant was removed. Cells were then resuspended in 5 mL of methanol:acetic acid fix (3 : 1), centrifuged at 500 g x 10 minutes, a procedure that was repeated a total of 3 times after removing the supernatant. Cells were then dropped onto microscope slides and stained with Wright’s stain, after which 25 metaphase spreads from each of a minimum of 3 different slides was analyzed for each sample. Microscopy was performed using an 100x objective on an Axio Imager A1 microscope (Zeiss, Oberkochen, Germany), with images captured using a CV-A10 digital camera (Jai, Yokohama, Japan) and Cytovision software (Leica Biosystems, Wetzlar, Germany).
For cell viability complementation assays, cells were treated with mitomycin C at the indicated doses (between 50–500 nM) and incubated with drug for 96h following which cell viability was measured by CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI).
Cell cycle complementation assay
Cell cycle analysis was performed on cells treated with vehicle (DMSO) or melphalan at the indicated doses for 48h. Cells were then fixed with 70% ethanol. Following this, cells were washed with PBS and then stained with PI/RNase Staining Buffer (BD Biosciences, San Jose, CA, USA). Cell Cycle analysis was performed on the Beckton-Dickinson LSR Fortessa or BD LSR II (BD, Franklin Lakes, NJ, USA).
Generation of isogenic BRCA2 haploinsufficient vs. wild-type T-ALL cells
We used Jurkat cells, which lack an identifiable BRCA2 mutation [39], to generate isogenic clones with monoallelic BRCA2 mutations. We first generated a guide RNA targeting exon 11 of BRCA2 (NM_000059; guide RNA target sequence TACAACTTGTGTAAAAAGCTA) in the guide RNA expression vector pHKO9-combomod-Puro [40]. This guide RNA was packaged into an integration deficient lentivirus by transfection into 293T cells, together with the integration-defective packaging plasmid psPAX2-D64V (https://www.addgene.org/63586/) and the pMD2.G envelope plasmid (https://www.addgene.org/12259/).
Jurkat T-ALL cells were first transduced with a blasticin-resistant Cas9 expression lentivirus (https://www.addgene.org/52962/), and selected with blasticidin for 10 days. Cells were then transduced with the integration-defective BRCA2-targeting guide RNA by incubating cells for 24 hours in virus-containing supernatant in the presence of polybrene at 8 μg/mL, and then subjected to selection with puromycin (2 μg/ml) for 24 hours, followed by single cell cloning using serial dilution. The BRCA2 target locus of these single-cell clones were Sanger sequenced using the following primers for PCR amplification: forward - 5-‘TGTGGTGCCACCTAAGCTCT-3’ and reverse - 5’-TCTGGTTGACCATCAAATATTCC-3’ and the forward primer was used for sequencing to identify those with monoallelic mutations predicted to result in premature termination of translation.
RNA sequencing of isogenic BRCA2 haploinsufficient vs. wild-type T-ALL cells
RNA was extracted from BRCA2 wild-type or heterozygous mutant clones using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. RNA samples were then treated with Ambion Turbo DNAse (Thermo Fisher Scientific, Waltham, MA), and DNA contamination was confirmed to be <10% for all samples. RNA quantity was determined using the Qubit RNA Assay Kit (Thermo Fisher Scientific) and RNA quality was determined on an Agilent Bioanalyzer using the RNA Pico Kit (Agilent, Santa Clara, CA). Using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA), 50–100 ng of total RNA was converted into a DNA library following the manufacturer’s protocol. Following library construction, DNA libraries were assessed for quality control. Library quantity was determined using the Qubit High Sensitivity DNA Kit (Thermo Fisher Scientific) and library size was determined using the Bioanalyzer High Sensitivity Chip Kit (Agilent). Finally, libraries were put through qPCR using the Universal Library Quantification Kit for Illumina (Kapa Biosystems, Wilmington, MA) and run on the 7900HT Fast qPCR machine (Applied Biosystems, Foster City, CA). Libraries passing quality control were diluted to 2 nM using sterile water and then sequenced on the NextSeq500 (Illumina, San Diego, CA) at a final concentration of 2 pM on a paired end flowcell with 75 sequencing cycles in each direction, following all manufacturer protocols. Alignments were performed with STAR aligner (version 2.3.1z4) against the hg19 w ERCC92 genome (ftp://ftp.ensembl.org/pub/release-75/fasta/homo_sapiens/dna/). Aligned files were processed to primary (raw) read counts using featureCounts, and primary read counts were normalized using DESeq2. Gene set enrichment analysis was performed using GenePattern (http://software.broadinstitute.org/cancer/software/genepattern). RNA-seq data are available in NCBI GEO (https://www.ncbi.nlm.nih.gov/geo), accession number GSE126780.
UV treatment in isogenic BRCA2 haploinsufficient vs. wild-type T-ALL cells
BRCA2 haploinsufficient Jurkat T-ALL clones W4 and W5, together with parental BRCA2 wild-type cells transduced with Cas9 alone, were suspended in 100 μL and plated at 10 million cells/ml in a 6-well plate. Cells were exposed to UV-C using the Stratalinker 2400 (Stratagene, La Jolla, CA) at 30 J/m2 or no UV. Cells were then plated at 0.1 million cells/mL in a 96-well plate, and cell viability was measured by CellTiter-Glo Cell Viability Assay after 96 hours.
In vitro drug treatment of isogenic BRCA2 haploinsufficient vs. wild-type T-ALL cells
BRCA2 haploinsufficient Jurkat T-ALL cells or their Cas9-transduced BRCA2 wild-type controls were plated at 0.1 million cells/ml in 96 well plates, and treated with vehicle (DMSO or PBS) control and at the indicated concentrations of VE-821 (SelleckChem, S8007), Topotecan (SelleckChem, S1231), KU60019 (SelleckChem, S1570), Mitomycin C (Sigma, M4287), PF-477736 (SelleckChem, S2904), Olaparib (SelleckChem, S1060), CCT-241533 (Tocris, 4968), Etoposide (Sigma, E1383), C527 (ApexBio, A8693), PHA-767491 (SelleckChem, S2742), MK-1775 (SelleckChem, S1525) for 96 hours. Cell viability was measured by CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI).
For 15-day treatment of BRCA2-haploinsufficient vs. wild-type controls, clone W4, clone W5, and parental Cas9 control cells were plated at 0.1 million cells/ml and split every 4 days at 1 : 9 in growth media (RPMI1640 with 10% FBS) in the presence of vehicle or drug. Cells were treated with VE821 (1 μM), AZD6738 (AstraZeneca, 0.25 μM), or vehicle (DMSO), and cell viability was measured by CellTiter-Glo Luminescent Cell Viability Assay when cells were split. Cell counts of drug-treated cells are normalized to those in vehicle-treated cells at that time point.
Mice
NOD rag gamma (NRG) mice were purchased from Jackson Laboratory (Bar Harbor, ME; strain #007799). 6 to 8-weeks old male NRG mice were used for experiments, and mice were randomly assigned to experimental groups. Mice were handled in accordance with Good Animal Practice as defined by the Office of Laboratory Animal Welfare, under approval from the Boston Children’s Hospital Institutional Animal Care and Use Committee (protocol # 18-09-3784R).
In vivo drug treatment of isogenic BRCA2 haploinsufficient vs. wild-type T-ALL cells
For in vivo experiments, BRCA2 haploinsufficient and their wild-type Cas9-expressing controls were transduced with either EGFP or dTomato expressing constructs. EGFP or dTomato protein-coding sequences were amplified in an attB-flanked PCR product from EX-EGFP-LV105 (Genecopoeia) or pUltra-Chili (https://www.addgene.org/48687/), respectively, and then Gateway-cloned into pLenti CMV Puro DEST (https://www.addgene.org/17452/). Lentivirus was generated as described above, and BRCA2 haploinsufficient clone W5 cells and parental Cas9 control cells were transduced with either pLenti CMV Puro DEST EGFP or dTomato lentivirus, as indicated. EGFP or dTomato positive cells were sorted using a Facsaria II (BD Biosciences). Sorting efficiency (>99.5%) was confirmed by FACS analysis before starting experiments. Cells were then mixed at 1 : 1 ratio, and injected by tail vein injection (0.5 million cells/mouse) into NRG mice. Mice were treated with irradiation (450 cGy) 3 hours prior to transplantation. Four days post-injection, treatment began with either vehicle (40% propylene glycol, 50% sterile water, and 10% DMSO) or AZD6738 (25 mg/kg) in this same vehicle by oral gavage, twice daily, for 12 days. Mice were anesthetized by 2% isoflurane (v/v) prior to oral gavage. Mice were monitored daily and supportive care (hydrogel, baconbites, and 300 μl normal saline solution via subcutaneous injection) were administered daily for the duration of the experiment. Mice were euthanized using carbon dioxide at day 18 after leukemia injection, the bone marrow was isolated and dissociated through a 40 μM mesh filter, and red blood cells were lysed using Red Blood Cell Lysis reagent (BD Biosciences). EGFP and dTomato fluorescence were assessed by flow cytometry using the LSRFortessa cytometer (BD Biosciences). Data were analyzed using FlowJo version 10.4.2.
Statistical analyses
Differences in categorical data were assessed via Fisher’s exact test. Differences in continuous data were assessed via the Welch t-test with Bonferroni correction for multiple hypothesis testing when variance was similar among the groups (standard deviations < 2-fold different), or via analysis of variance (ANOVA) with Dunnett’s adjustment for multiple hypothesis testing when variance was similar. Differences in event-free and overall survival were assessed by the log-rank test, and time-to-event distributions were estimated via the Kaplan-Meier method.
Results
Fanconi-BRCA mutations in human T-ALL
To further unravel the genetic basis of T-ALL, we applied targeted exon sequencing and array CGH analysis to T-ALL diagnostic specimens collected from a cohort of children treated on contemporary clinical trials (S2 Table). Sequencing analysis revealed 10 missense or splice site alterations of Fanconi genes in 23% (n = 9 of 40) of T-ALL cases analyzed in our primary cohort (Figs 1A and 2B, S2 and S3 Tables). All mutations were present at variant allele fractions of 0.38–0.54, consistent with heterozygous clonal mutations in the bulk tumor population (S3 Table). All mutations were validated by Sanger sequencing (S1 Fig). To validate these findings in an independent cohort, we subjected an additional cohort of 69 independent primary T-ALL patient samples to targeted sequencing analysis. This revealed Fanconi-BRCA pathway mutations in 17% (n = 12 of 69) of these cases (S4 and S5 Tables), an incidence not significantly different than that in our original cohort (P = 0.6).
Fig. 1. Fanconi-BRCA pathway mutations in childhood T-ALL. (A) Childhood T-ALL diagnostic specimens were analyzed by targeted exon sequencing and array CGH. The percentage of cases with mutations or deletions in each of the Fanconi complexes is shown on a simplified schema of the Fanconi pathway, which functions in the repair of DNA inter-strand crosslinks. (B) Mutations identified by targeted exon sequencing are shown for each of the mutated Fanconi-BRCA pathway genes. Allele fraction of the mutation is shown in parentheses. (C-D) Comparison of white blood cell (WBC) count (C) or patient age (D) at the time of T-ALL diagnosis in cases with or without Fanconi gene alterations. Significance assessed by two-sided Wilcoxon rank-sum test. (E) Co-occurrence of Fanconi gene mutations with additional T-ALL oncogenic lesions identified by sequencing and copy number analysis. Fig. 2. Fanconi-BRCA mutations in T-ALL encode pathogenic alleles. A panel of cell lines deficient for BRCA2 (VU423), FANCD2 (PD20), FANCA (GM6914), FANCC (PD331) or FANCF (EUFA121.L) were transfected with pcDNA3 (BRCA2) or retrovirally infected with PMMP expression constructs encoding the wild-type (WT) gene (FANCD2, FANCA, FANCC, FANCF), control vector, or each of the indicated point mutant alleles identified in T-ALL patient samples. (A) Relative mRNA expression of the transduced genes was assessed by Q-RT-PCR analysis. All units are % of β-actin control. (B) The indicated cells were treated with mitomycin C (MMC; 20 ng/mL) for 48 hours, and radial chromosome formation was assessed by metaphase spread analysis. Radial chromosome formation was assessed in a minimum of 25 metaphases from each of three independent biologic replicates for each condition, and are plotted as mean +/- s.e.m. (C) Representative metaphase spread from the experiment shown in (B), with black arrows denoting radial chromosomes. (D) Relative viability was assessed by CellTiterGlo in the indicated cells transduced with the indicated constructs, following treatment with mitomycin C (MMC) at the following dosing: BRCA2 cells, 500 nM; FANCD2 cells, 100 nM; FANCA cells, 100 nM; FANCC cells, 500 nM; FANCF cells, 50 nM. (E) Cell cycle analysis was performed by PI staining in each of the transduced cell lines following treatment with melphalan at 0.25 μg/ml (BRCA2, FANCD2, FANCA, FANCC) or 0.5 μg/ml (FANCF) for 48 hours. The change in the percentage of cells in G2/M is shown relative to that in DMSO vehicle-treated cells. (F) Representative histograms of DNA content (PI) for each of the FANCF transduced cells in (E) are shown. All bar charts represent the mean +/- s.e.m. of three independent biologic replicates, with significance assessed by Welch t-test with Bonferroni adjustment for multiple comparisons as appropriate. ***, P ≤ 0.001; **, P ≤ 0.01; *, P ≤ 0.05; n.s., P > 0.05. Sequencing of remission specimens of samples in the 8 Fanconi-BRCA mutant cases in our primary cohort in which induction chemotherapy successfully cleared the bone marrow of leukemia revealed that 6 of these mutations were somatic, whereas 2 were present in the remission specimen (S1 Fig), suggesting a germline origin. In addition, array CGH analysis of our primary T-ALL cohort revealed 8 deletions involving Fanconi genes as part of large multi-gene chromosomal aberrations in 19% (n = 7 of 36) of cases with sufficient material for array CGH analysis (Fig 1A, S2 Fig, S2 Table). Overall, 15 (38%) of the 40 T-ALLs in the primary T-ALL cohort analyzed had Fanconi-BRCA gene alterations. These cases had a significantly increased WBC count (Fig 1C), and tended to be younger at the time of T-ALL diagnosis (Fig 1D). Strikingly, all 5 T-ALL cases diagnosed before 6 years of age had Fanconi-BRCA mutations (5/5 vs. 10/25 in older patients, P = 0.005 by Fisher’s exact test). There were no significant differences in clinical responses between Fanconi-BRCA mutant vs. wild-type cases (S3 Fig). Fanconi alterations frequently co-occurred with mutations of NOTCH1, CDKN2A and polycomb repressive complex 2 genes (Fig 1E, S3 Table), genes with well-established roles in T-ALL pathogenesis [41, 42], but Fanconi-BRCA mutations were not significantly associated with specific molecular subtypes of T-ALL. A comparison of variant allele fractions for these mutations revealed that Fanconi-BRCA mutations were most likely clonal (S2 and S3 Tables).
Fanconi-BRCA mutations identified in T-ALL encode pathogenic alleles
To test whether the identified Fanconi-BRCA mutations are pathogenic, we leveraged complementation analysis in a panel of cell lines with biallelic loss-of-function mutations in BRCA2, FANCD2, FANCA, FANCC or FANCF [43, 44]. We note that none of the mutations we identified are known to be pathogenic, and most have not been previously reported in Fanconi or BRCA mutation databases (S2 Table). Fanconi-deficient cells were transduced with expression constructs encoding point mutant alleles identified, the respective wild-type gene, or a negative control. The wild-type and mutant constructs were expressed at similar levels based on Q-RT-PCR and Western blot analysis (Fig 2A and S5 Fig). Transduced cells were treated with the DNA cross-linking agent mitomycin C, and radial chromosome formation was assessed by metaphase spread analysis. This revealed that most of the Fanconi-BRCA mutant alleles tested were impaired in their ability to rescue radial chromosome formation when compared to the wild-type gene (Fig 2B and 2C). For example, the FANCD2 Q413E allele was indistinguishable from a negative control, whereas FANCC S264R was approximately 75% as efficient as wild-type at reducing radial chromosome formation. All mutant alleles except FANCA P259A were also impaired in their ability to rescue Fanconi-deficient cells from the cytotoxicity of mitomycin C (Fig 2D). We then tested whether these mutant alleles were impaired in their ability to rescue G2/M arrest in response to melphalan, an alternative assay for canonical Fanconi pathway function [45], and found that most of the mutant alleles tested were inferior to their corresponding wild-type genes in this assay as well (Fig 2E and 2F). Thus, while some alleles are only modestly impaired, these data indicate that Fanconi-BRCA mutations identified in childhood T-ALL encode hypomorphic or null alleles.
Inactivating the tumor suppressor activity of the Fanconi-BRCA pathway is generally thought to require biallelic gene mutations, and biallelic gene mutations are detectable in 90% of BRCA-mutant breast cancers [9]. However, there were no biallelic Fanconi-BRCA gene mutations identified in any T-ALL sample in our cohort (S2 Table). Moreover, Sanger sequencing from mRNA of Fanconi-mutant T-ALLs suggested that 8 of the 9 Fanconi-mutant cases retained mRNA expression of the wild-type allele (Fig 3A, S1 Fig). To test whether the wild-type allele is functional, we took advantage of the fact that cells with biallelic, but not monoallelic, Fanconi-BRCA pathway mutations have gross defects in the repair of DNA cross-links, detectable as hypersensitivity to inter-chromosomal fusions (radial chromosomes) in response to DNA cross-linking agents [46], and are hypersensitive to the cytotoxicity of PARP inhibitors [27, 47, 48]. Treatment of T-ALL patient-derived xenograft (PDX) cells harboring a heterozygous truncating BRCA2 p.Y1710X mutation (Fig 3A) revealed that these cells lacked hypersensitivity to mitomycin C-induced radial chromosome formation (Fig 3B). These cells also harbored no hypersensitivity to the PARP inhibitor olaparib, at doses that were highly toxic to BRCA2-null VU423 cells (Fig 3C). While we lacked additional viable Fanconi-BRCA mutant T-ALL cells to confirm that these findings are generalizable to T-ALLs with upstream Fanconi gene mutations, these data suggest that T-ALLs are under little selective pressure to completely inactivate the wild-type allele.
Fig. 3. T-ALLs with monoallelic Fanconi-BRCA mutations retain expression of the wild-type allele. BRCA2 haploinsufficient T-ALL cells are hypersensitive to ultraviolet irradiation and ATR inhibition
We then turned our attention to the cellular consequences of BRCA2 haploinsufficiency in T-ALL, because this was the single most commonly mutated Fanconi-BRCA gene in this cohort (Fig 1B). We first generated isogenic BRCA2 wild-type versus haploinsufficient T-ALL cells in the human cell line Jurkat. We selected Jurkat cells because sequencing has identified no pathogenic mutations in BRCA2 or other Fanconi-BRCA pathway genes [39]. Cas9-expressing Jurkat cells were transiently transduced with an integration-defective lentivirus encoding a guide RNA targeting exon 11 (the exon mutated in T-ALL PDX D115), and single-cell cloning revealed two independent clones with monoallelic mutations predicted to result in premature termination of translation (Fig 4A and 4B). There was no significant difference in relative viability of BRCA2 haploinsufficient versus parental clones (S6 Fig).
Fig. 4. BRCA2 haploinsufficiency induces sensitivity to ultraviolet irradiation. (A-B) Cas9-expressing Jurkat T-ALL cells were transiently transduced with a guide RNA targeting the locus indicated in (A). Cells were single cell cloned, and Sanger sequencing identified the two clones with monoallelic frameshift mutations shown in (B). (C) RNA-seq was performed on the two BRCA2 haploinsufficient clones, together with parental or Cas9-transduced Jurkat controls, and gene set enrichment analysis was performed. NES, normalized enrichment score. (D) An equal number of the indicated cells were subjected to 30 J/m2 ultraviolet irradiation, and viability was assessed at 96 hours. (E) Viability was normalized to that in non-irradiated controls. Significance was assessed by Welch t test. We began by performing RNA-seq analysis on these two BRCA2-haploinsufficient Jurkat clones, together with two BRCA2 wild-type control clones (Cas9-expressing and untransduced parental Jurkat cells). Gene set enrichment analysis revealed that BRCA2 haploinsufficiency was associated with increased expression of the Hallmark_DNA_Repair gene set (Fig 4C), representing genes whose coordinate expression is associated with DNA damage repair in a broad spectrum of experimental conditions [49]. BRCA2 haploinsufficient cells were also characterized by increased expression of genes upregulated in response to ultraviolet (UV) irradiation, and decreased expression of genes downregulated in the UV response (Fig 4D), suggesting that BRCA2 haploinsufficient cells might have limited reserves to tolerate UV irradiation. UV radiation induces pyrimidine dimers that are typically repaired by nucleotide excision repair or trans-lesion synthesis [50]. However, UV radiation during S phase does trigger activation of the Fanconi-BRCA pathway [51], and FANCD2 function is required for genomic integrity following UV-induced replication stress [52]. We found that BRCA2-haploinsufficient cells were selectively sensitized to UV irradiation at doses that had minimal toxicity to their isogenic wild-type counterparts (Fig 4E).
We then asked whether therapeutic vulnerabilities induced by BRCA2 haploinsufficiency could be exploited using drugs. We screened a panel of small molecules selected based on their potential to trigger DNA replication-dependent toxicity, in BRCA2 haploinsufficient clone W5 cells versus their isogenic wild-type counterparts (S7 Fig). This revealed that the ATR inhibitor VE-821 [53] was selectively toxic to cells harboring monoallelic BRCA2 mutations following 4 days of treatment (Fig 5A). To confirm these findings, we then treated our two independent BRCA2 haploinsufficient clones with either VE-821 or the structurally distinct ATR inhibitor AZD6738 [54], and found that ATR inhibition exhibits sustained differential toxicity to BRCA2 haploinsufficient Jurkat T-ALL cells (Fig 5B and 5C). While T-ALL patient-derived xenografts are unable to be maintained in cell culture for more than a few days, short-term treatment of a panel of T-ALL PDX cells revealed that the ATR inhibitor AZD6738 was toxic only to those from a case harboring a monoallelic BRCA2 truncating mutation (Fig 5D).
Fig. 5. BRCA2 haploinsufficiency induces hypersensitivity to ATR inhibition. (A) Jurkat BRCA2-haploinsufficient clone W5 cells, and Cas9-transduced parental controls, were treated with the indicated drugs for 96 hours, and viability was assessed using CellTiter Glo. Graph denotes the mean +/- s.e.m. of the fold change in IC50 between BRCA2 +/- versus parental cells from triplicate experiments. Significance assessed by repeated measures two-way ANOVA. (B-C) The indicated BRCA2 haploinsufficient Jurkat clones, or Cas9-transduced parental controls, were treated with the ATR inhbitors VE-821 (1 μM) or AZD6738 (0.25 μM), and cell viability was assessed by CellTiter Glo at the indicated time points. Graphs denotes the mean +/- s.e.m. of biologic triplicates. (D) T-ALL patient-derived xenograft (PDX) cells were treated for 4 days with AZD6738 (0.8 mM), and viability was assessed by CellTiter Glo. Graph denotes the mean +/- s.e.m. of biologic triplicates. Significance assessed by one-way ANOVA with Dunnett’s correction for multiple hypothesis testing. (E) Schema of experimental design. Vehicle or 25 mg/kg/dose AZD6738 were administered by gavage every 12 hr. (F) Mice were injected with a 1:1 mix of dTomato-labeled BRCA2 haploinsufficient clone W5 and EGFP-transduced parental Cas9 (BRCA2 wild-type) cells, and treated as shown in (E). Abundance of each fluorescently labeled clone in the bone marrow was assessed by flow cytometry on day 18. Significance was assessed by two-sided Welch t-test. (G) Representative flow cytometry plots from the experiment shown in (E). (H-I) Mice were injected, treated and analyzed as in (F-G), with the fluorescent labels swapped: BRCA2 haploinsufficient cells were transduced with EGFP, and parental Cas9 (BRCA2 wild-type) cells were transduced with dTomato. ***, P ≤ 0.001; **, P ≤ 0.01; *, P ≤ 0.05; n.s., P > 0.05. To test the in vivo therapeutic potential of ATR inhibition in BRCA2 haploinsufficient T-ALL, we first transduced BRCA2-haploinsufficient clone W5 cells with EGFP, and their isogenic parental cells with dTomato. These cells were mixed in a 1 : 1 ratio, and injected into a cohort of immunodeficient mice. Four days after injection, mice were treated either with vehicle or the ATR inhibitor AZD6738 via gavage for 12 days, and relative fitness of BRCA2 mutant versus wild-type clones was assessed by flow cytometry analysis of the bone marrow. This experimental design ensures that both clones are treated under identical conditions. BRCA2 haploinsufficient versus wild-type clones had indistinguishable growth characteristics in vehicle-treated mice. However, we found that the ATR inhibitor AZD6738 was selectively toxic to T-ALL cells harboring a monoallelic BRCA2 mutation (Fig 5F and 5G). To rule out the possibility that this result reflected differential toxicity of the EGFP versus dTomato fluorescent proteins, we repeated this experiment with the labels swapped, which revealed nearly identical results (Fig 5H and 5I). Thus, BRCA2 haploinsufficiency selectively sensitizes T-ALLs to ATR inhibition.
Discussion
The identification of a high frequency of pathogenic Fanconi-BRCA mutations implicates this pathway in the molecular pathogenesis of human T-ALL, a possibility first raised by the spontaneous development of thymic lymphomas in Brca2-deficient mice [17, 18]. While T-cell transformation can occur with biallelic Fanconi-BRCA pathway mutations [17–19], the fact that all mutations in human T-ALL appeared to be monoallelic suggests that partially impaired, rather than absent, Fanconi pathway activity may provide optimal fitness during T-cell transformation. This model posits that Fanconi-BRCA haploinsufficiency sufficiently impairs some functions of the pathway to collaborate with other oncogenic lesions during T-cell transformation. Haploinsufficiency for some downstream Fanconi-BRCA genes has previously been shown to induce replication stress and impair DNA repair [55, 56], and we found that BRCA2 haploinsufficiency induced gene expression alterations suggesting activation of a DNA damage response, as well as hypersensitivity to UV radiation. However, the lack of selection for loss of the wild-type allele suggests that retaining some Fanconi pathway function is beneficial, presumably by suppressing the deleterious consequences of extensive genomic instability. The relative specificity of this observation to the T-cell lineage may reflect the hypersensitivity of normal T-cell progenitors to DNA damage-induced apoptosis [57]. However, this is not unique to the T-cell lineage, as BRCA2 can function as a haploinsufficient tumor suppressor during pancreatic transformation [58].
It is worth noting that a recent whole-exome sequencing (WES) study of a large T-ALL cohort detected a significantly lower rate of Fanconi-BRCA mutations than that reported in our study [59]. We confirmed each of the mutations identified in our cohort by Sanger sequencing, which rules out the possibility of next-generation sequencing artifacts, and also validated our findings in an independent cohort. We believe this apparent discrepancy reflects the difficulty of distinguishing pathogenic mutations from non-pathogenic passengers by informatics alone. The authors of this recent WES study applied a strict algorithm for mutation calling, which required mutations to be previously known to be pathogenic or clearly predicted to disrupt protein structure [59]. This is entirely appropriate, because without this the list of mutations identified in genome-wide cancer sequencing studies would be dominated by non-pathogenic variants, which are much more common. However, an unavoidable consequence of this approach is a bias against calling mutations not previously known to be pathogenic. We note that most of the pathogenic Fanconi-BRCA mutations we identified were missense substitutions not previously known to be pathogenic, and their functional impairment was not well correlated with predicted pathogenicity by a range of existing informatics tools, in line with prior reports [60, 61]. We note that recent efforts using novel informatics algorithms designed to better predict pathogenic mutations have also revealed Fanconi-BRCA mutations in other tumor types in which these had not previously been recognized by large-scale sequencing efforts [62–64]. These findings highlight the complementary strengths of human cancer genomics and functional genetics to decipher the molecular pathogenesis of human cancer.
We found that haploinsufficiency for BRCA2, the most commonly mutated Fanconi gene in our cohort, induced a gene expression signature suggesting activation of a DNA damage response, and BRCA2 haploinsufficient cells were hypersensitive to UV radiation at doses that lacked detectable toxicity to their wild-type counterparts. These cells were also selectively sensitized to ATR inhibition, but not to drugs such as PARP inhibitors that are toxic only in the setting of biallelic (and not monoallelic) Fanconi-BRCA inactivating mutations [27, 47, 48]. Our data provide a rationale for the application of ATR inhibitors in T-ALLs with somatic BRCA gene mutations, and suggest the need to test this strategy in other tumors with monoallelic Fanconi-BRCA gene mutations. ATR inhibitors are currently in clinical trials for a broad spectrum of tumor types, and it will be of considerable interest to assess whether Fanconi-BRCA mutations provide a biomarker of response to ATR inhibition across human cancer subtypes.
Supporting information
S1 Fig [left]
Confirmation of Fanconi-BRCA point mutations identified in childhood T-ALL by Sanger sequencing.S2 Fig [a]
Fanconi deletions in childhood T-ALL.S3 Fig [pdf]
Fanconi mutations are not associated with T-ALL treatment response.S4 Fig [a]
Western blot analysis of Fanconi-BRCA deficient cells transduced with wild-type or mutant expression constructs for complementation experiments shown in .S5 Fig [pdf]
The D115 T-ALL patient-derived xenograft harbors a BRCA2 heterozygous mutation.S6 Fig [pdf]
Baseline viability of BRCA2 haploinsufficient vs. parental Cas9 isogenic clones.S7 Fig [pdf]
Viability curves of BRCA2 haploinsufficient vs. parental Cas9 isogenic clones upon treatment with the drugs shown in .S1 Table [xlsx]
Genes sequenced by targeted exon sequencing.S2 Table [xlsx]
Primary T-All patient samples analyzed in Primary Patient Cohort.S3 Table [xlsx]
Results of targeted exon sequencing in Primary Patient Cohort.S4 Table [xlsx]
Primary T-All patient samples analyzed in Validation Patient Cohort.S5 Table [xlsx]
Results of targeted exon sequencing in Validation Patient Cohort.S6 Table [xlsx]
Primers used for PCR amplification, Sanger sequencing, site-directed mutagenesis, and quantitative PCR.
Zdroje
1. Ceccaldi R, Sarangi P, D’Andrea AD. The Fanconi anaemia pathway: new players and new functions. Nature reviews Molecular cell biology. 2016;17(6):337–49. doi: 10.1038/nrm.2016.48 27145721
2. NCBI OMIM: Online Mendelian Inheritance in Man. MIM Number: 175100. https://omim.org/entry/175100. Accessed December 12, 2018. [Internet].
3. Nishisho I, Nakamura Y, Miyoshi Y, Miki Y, Ando H, Horii A, et al. Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Science. 1991;253(5020):665–9. doi: 10.1126/science.1651563 1651563
4. Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, et al. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 1991;66(3):589–600. doi: 10.1016/0092-8674(81)90021-0 1651174
5. Kinzler KW, Nilbert MC, Su LK, Vogelstein B, Bryan TM, Levy DB, et al. Identification of FAP locus genes from chromosome 5q21. Science. 1991;253(5020):661–5. doi: 10.1126/science.1651562 1651562
6. Yaeger R, Chatila WK, Lipsyc MD, Hechtman JF, Cercek A, Sanchez-Vega F, et al. Clinical Sequencing Defines the Genomic Landscape of Metastatic Colorectal Cancer. Cancer Cell. 2018;33(1):125–36 e3. doi: 10.1016/j.ccell.2017.12.004 29316426
7. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science. 1994;265(5181):2088–90. doi: 10.1126/science.8091231 8091231
8. Friedman LS, Ostermeyer EA, Szabo CI, Dowd P, Lynch ED, Rowell SE, et al. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet. 1994;8(4):399–404. doi: 10.1038/ng1294-399 7894493
9. Nik-Zainal S, Davies H, Staaf J, Ramakrishna M, Glodzik D, Zou X, et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature. 2016;534(7605):47–54. doi: 10.1038/nature17676 27135926
10. Cancer Genome Atlas Research N. Integrated genomic analyses of ovarian carcinoma. Nature. 2011;474(7353):609–15. doi: 10.1038/nature10166 21720365
11. Struewing JP, Hartge P, Wacholder S, Baker SM, Berlin M, McAdams M, et al. The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. N Engl J Med. 1997;336(20):1401–8. doi: 10.1056/NEJM199705153362001 9145676
12. Breast Cancer Linkage C. Cancer risks in BRCA2 mutation carriers. Journal of the National Cancer Institute. 1999;91(15):1310–6. doi: 10.1093/jnci/91.15.1310 10433620
13. Waddell N, Pajic M, Patch AM, Chang DK, Kassahn KS, Bailey P, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495–501. doi: 10.1038/nature14169 25719666
14. Neidhardt G, Hauke J, Ramser J, Gross E, Gehrig A, Muller CR, et al. Association Between Loss-of-Function Mutations Within the FANCM Gene and Early-Onset Familial Breast Cancer. JAMA Oncol. 2017;3(9):1245–8. doi: 10.1001/jamaoncol.2016.5592 28033443
15. Kiiski JI, Pelttari LM, Khan S, Freysteinsdottir ES, Reynisdottir I, Hart SN, et al. Exome sequencing identifies FANCM as a susceptibility gene for triple-negative breast cancer. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(42):15172–7. doi: 10.1073/pnas.1407909111 25288723
16. Alter BP. Fanconi anemia and the development of leukemia. Best Pract Res Clin Haematol. 2014;27(3–4):214–21. doi: 10.1016/j.beha.2014.10.002 25455269
17. Connor F, Bertwistle D, Mee PJ, Ross GM, Swift S, Grigorieva E, et al. Tumorigenesis and a DNA repair defect in mice with a truncating Brca2 mutation. Nat Genet. 1997;17(4):423–30. doi: 10.1038/ng1297-423 9398843
18. Friedman LS, Thistlethwaite FC, Patel KJ, Yu VP, Lee H, Venkitaraman AR, et al. Thymic lymphomas in mice with a truncating mutation in Brca2. Cancer Res. 1998;58(7):1338–43. 9537225
19. Cerabona D, Sun Z, Nalepa G. Leukemia and chromosomal instability in aged Fancc-/ - mice. Exp Hematol. 2016;44(5):352–7. doi: 10.1016/j.exphem.2016.01.009 26860989
20. Smetsers S, Muter J, Bristow C, Patel L, Chandler K, Bonney D, et al. Heterozygote FANCD2 mutations associated with childhood T Cell ALL and testicular seminoma. Familial cancer. 2012;11(4):661–5. doi: 10.1007/s10689-012-9553-3 22829014
21. Rischewski JR, Clausen H, Leber V, Niemeyer C, Ritter J, Schindler D, et al. A heterozygous frameshift mutation in the Fanconi anemia C gene in familial T-ALL and secondary malignancy. Klin Padiatr. 2000;212(4):174–6. doi: 10.1055/s-2000-9673 10994546
22. Borriello A, Locasciulli A, Bianco AM, Criscuolo M, Conti V, Grammatico P, et al. A novel Leu153Ser mutation of the Fanconi anemia FANCD2 gene is associated with severe chemotherapy toxicity in a pediatric T-cell acute lymphoblastic leukemia. Leukemia. 2007;21(1):72–8. doi: 10.1038/sj.leu.2404468 17096012
23. Goldsby RE, Perkins SL, Virshup DM, Brothman AR, Bruggers CS. Lymphoblastic lymphoma and excessive toxicity from chemotherapy: an unusual presentation for Fanconi anemia. J Pediatr Hematol Oncol. 1999;21(3):240–3. 10363859
24. Svojgr K, Sumerauer D, Puchmajerova A, Vicha A, Hrusak O, Michalova K, et al. Fanconi anemia with biallelic FANCD1/BRCA2 mutations—Case report of a family with three affected children. Eur J Med Genet. 2016;59(3):152–7. doi: 10.1016/j.ejmg.2015.11.013 26657402
25. Fong PC, Boss DS, Yap TA, Tutt A, Wu P, Mergui-Roelvink M, et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N Engl J Med. 2009;361(2):123–34. doi: 10.1056/NEJMoa0900212 19553641
26. Tutt A, Robson M, Garber JE, Domchek SM, Audeh MW, Weitzel JN, et al. Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet. 2010;376(9737):235–44. doi: 10.1016/S0140-6736(10)60892-6 20609467
27. Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 2005;434(7035):917–21. doi: 10.1038/nature03445 15829967
28. Sholl LM, Do K, Shivdasani P, Cerami E, Dubuc AM, Kuo FC, et al. Institutional implementation of clinical tumor profiling on an unselected cancer population. JCI Insight. 2016;1(19):e87062. doi: 10.1172/jci.insight.87062 27882345
29. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20(9):1297–303. doi: 10.1101/gr.107524.110 20644199
30. Sawyer SL, Tian L, Kahkonen M, Schwartzentruber J, Kircher M, University of Washington Centre for Mendelian G, et al. Biallelic mutations in BRCA1 cause a new Fanconi anemia subtype. Cancer discovery. 2015;5(2):135–42. doi: 10.1158/2159-8290.CD-14-1156 25472942
31. Menten B, Pattyn F, De Preter K, Robbrecht P, Michels E, Buysse K, et al. arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays. BMC Bioinformatics. 2005;6 : 124. doi: 10.1186/1471-2105-6-124 15910681
32. Gutierrez A, Sanda T, Ma W, Zhang J, Grebliunaite R, Dahlberg S, et al. Inactivation of LEF1 in T-cell acute lymphoblastic leukemia. Blood. 2010;115(14):2845–51. doi: 10.1182/blood-2009-07-234377 20124220
33. Townsend EC, Murakami MA, Christodoulou A, Christie AL, Koster J, DeSouza TA, et al. The Public Repository of Xenografts Enables Discovery and Randomized Phase II-like Trials in Mice. Cancer Cell. 2016;29(4):574–86. doi: 10.1016/j.ccell.2016.03.008 27070704
34. Howlett NG, Taniguchi T, Olson S, Cox B, Waisfisz Q, De Die-Smulders C, et al. Biallelic inactivation of BRCA2 in Fanconi anemia. Science. 2002;297(5581):606–9. doi: 10.1126/science.1073834 12065746
35. Timmers C, Taniguchi T, Hejna J, Reifsteck C, Lucas L, Bruun D, et al. Positional cloning of a novel Fanconi anemia gene, FANCD2. Mol Cell. 2001;7(2):241–8. 11239453
36. Naf D, Kupfer GM, Suliman A, Lambert K, D’Andrea AD. Functional activity of the fanconi anemia protein FAA requires FAC binding and nuclear localization. Mol Cell Biol. 1998;18(10):5952–60. doi: 10.1128/mcb.18.10.5952 9742112
37. Hirano S, Yamamoto K, Ishiai M, Yamazoe M, Seki M, Matsushita N, et al. Functional relationships of FANCC to homologous recombination, translesion synthesis, and BLM. EMBO J. 2005;24(2):418–27. doi: 10.1038/sj.emboj.7600534 15616572
38. de Winter JP, Rooimans MA, van Der Weel L, van Berkel CG, Alon N, Bosnoyan-Collins L, et al. The Fanconi anaemia gene FANCF encodes a novel protein with homology to ROM. Nat Genet. 2000;24(1):15–6. doi: 10.1038/71626 10615118
39. Tate JG, Bamford S, Jubb HC, Sondka Z, Beare DM, Bindal N, et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res. 2018.
40. Aries IM, Bodaar K, Karim SA, Chonghaile TN, Hinze L, Burns MA, et al. PRC2 loss induces chemoresistance by repressing apoptosis in T cell acute lymphoblastic leukemia. J Exp Med. 2018;215(12):3094–114. doi: 10.1084/jem.20180570 30404791
41. Girardi T, Vicente C, Cools J, De Keersmaecker K. The genetics and molecular biology of T-ALL. Blood. 2017;129(9):1113–23. doi: 10.1182/blood-2016-10-706465 28115373
42. Sanchez-Martin M, Ferrando A. The NOTCH1-MYC highway toward T-cell acute lymphoblastic leukemia. Blood. 2017;129(9):1124–33. doi: 10.1182/blood-2016-09-692582 28115368
43. Strathdee CA, Gavish H, Shannon WR, Buchwald M. Cloning of cDNAs for Fanconi’s anaemia by functional complementation. Nature. 1992;356(6372):763–7. doi: 10.1038/356763a0 1574115
44. Pulsipher M, Kupfer GM, Naf D, Suliman A, Lee JS, Jakobs P, et al. Subtyping analysis of Fanconi anemia by immunoblotting and retroviral gene transfer. Molecular medicine. 1998;4(7):468–79. 9713825
45. Chandra S, Levran O, Jurickova I, Maas C, Kapur R, Schindler D, et al. A rapid method for retrovirus-mediated identification of complementation groups in Fanconi anemia patients. Mol Ther. 2005;12(5):976–84. doi: 10.1016/j.ymthe.2005.04.021 16084127
46. Auerbach AD, Wolman SR. Susceptibility of Fanconi’s anaemia fibroblasts to chromosome damage by carcinogens. Nature. 1976;261(5560):494–6. doi: 10.1038/261494a0 934283
47. McCabe N, Turner NC, Lord CJ, Kluzek K, Bialkowska A, Swift S, et al. Deficiency in the repair of DNA damage by homologous recombination and sensitivity to poly(ADP-ribose) polymerase inhibition. Cancer Res. 2006;66(16):8109–15. doi: 10.1158/0008-5472.CAN-06-0140 16912188
48. Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, Lopez E, et al. Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature. 2005;434(7035):913–7. doi: 10.1038/nature03443 15829966
49. Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417–25. doi: 10.1016/j.cels.2015.12.004 26771021
50. Tubbs A, Nussenzweig A. Endogenous DNA Damage as a Source of Genomic Instability in Cancer. Cell. 2017;168(4):644–56. doi: 10.1016/j.cell.2017.01.002 28187286
51. Dunn J, Potter M, Rees A, Runger TM. Activation of the Fanconi anemia/BRCA pathway and recombination repair in the cellular response to solar ultraviolet light. Cancer Res. 2006;66(23):11140–7. doi: 10.1158/0008-5472.CAN-06-0563 17145857
52. Federico MB, Vallerga MB, Radl A, Paviolo NS, Bocco JL, Di Giorgio M, et al. Chromosomal Integrity after UV Irradiation Requires FANCD2-Mediated Repair of Double Strand Breaks. PLoS Genet. 2016;12(1):e1005792. doi: 10.1371/journal.pgen.1005792 26765540
53. Reaper PM, Griffiths MR, Long JM, Charrier JD, Maccormick S, Charlton PA, et al. Selective killing of ATM - or p53-deficient cancer cells through inhibition of ATR. Nat Chem Biol. 2011;7(7):428–30. doi: 10.1038/nchembio.573 21490603
54. Foote KM, Nissink JWM, McGuire T, Turner P, Guichard S, Yates JWT, et al. Discovery and Characterization of AZD6738, a Potent Inhibitor of Ataxia Telangiectasia Mutated and Rad3 Related (ATR) Kinase with Application as an Anticancer Agent. J Med Chem. 2018;61(22):9889–907. doi: 10.1021/acs.jmedchem.8b01187 30346772
55. Pathania S, Bade S, Le Guillou M, Burke K, Reed R, Bowman-Colin C, et al. BRCA1 haploinsufficiency for replication stress suppression in primary cells. Nature communications. 2014;5 : 5496. doi: 10.1038/ncomms6496 25400221
56. Obermeier K, Sachsenweger J, Friedl TW, Pospiech H, Winqvist R, Wiesmuller L. Heterozygous PALB2 c.1592delT mutation channels DNA double-strand break repair into error-prone pathways in breast cancer patients. Oncogene. 2016;35(29):3796–806. doi: 10.1038/onc.2015.448 26640152
57. Strasser A, Harris AW, Cory S. bcl-2 transgene inhibits T cell death and perturbs thymic self-censorship. Cell. 1991;67(5):889–99. doi: 10.1016/0092-8674(91)90362-3 1959134
58. Skoulidis F, Cassidy LD, Pisupati V, Jonasson JG, Bjarnason H, Eyfjord JE, et al. Germline Brca2 heterozygosity promotes Kras(G12D) -driven carcinogenesis in a murine model of familial pancreatic cancer. Cancer Cell. 2010;18(5):499–509. doi: 10.1016/j.ccr.2010.10.015 21056012
59. Liu Y, Easton J, Shao Y, Maciaszek J, Wang Z, Wilkinson MR, et al. The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat Genet. 2017;49(8):1211–8. doi: 10.1038/ng.3909 28671688
60. Thusberg J, Olatubosun A, Vihinen M. Performance of mutation pathogenicity prediction methods on missense variants. Hum Mutat. 2011;32(4):358–68. doi: 10.1002/humu.21445 21412949
61. Frousios K, Iliopoulos CS, Schlitt T, Simpson MA. Predicting the functional consequences of non-synonymous DNA sequence variants—evaluation of bioinformatics tools and development of a consensus strategy. Genomics. 2013;102(4):223–8. doi: 10.1016/j.ygeno.2013.06.005 23831115
62. Madubata CJ, Roshan-Ghias A, Chu T, Resnick S, Zhao J, Arnes L, et al. Identification of potentially oncogenic alterations from tumor-only samples reveals Fanconi anemia pathway mutations in bladder carcinomas. NPJ Genom Med. 2017;2 : 29. doi: 10.1038/s41525-017-0032-5 29263839
63. Cancer Genome Atlas Research N. Comprehensive molecular characterization of urothelial bladder carcinoma. Nature. 2014;507(7492):315–22. doi: 10.1038/nature12965 24476821
64. Maung KZY, Leo PJ, Bassal M, Casolari DA, Gray JX, Bray SC, et al. Rare variants in Fanconi anemia genes are enriched in acute myeloid leukemia. Blood Cancer J. 2018;8(6):50. doi: 10.1038/s41408-018-0090-7 29891941
Článek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cellsČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviourČlánek Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
Článok vyšiel v časopisePLOS One
Najčítanejšie tento týždeň
2019 Číslo 11- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Masturbační chování žen v ČR − dotazníková studie
- Nejasný stín na plicích – kazuistika
- Postup rychlého zotavení po operaci zlomeniny krčku femuru
- Aktuální poznatky v problematice hojení ran: Mezioborová spolupráce při léčbě ran a kožních defektů – XIV. celostátní kongres s mezinárodní účastí
-
Všetky články tohto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy